ID: 953380075

View in Genome Browser
Species Human (GRCh38)
Location 3:42463351-42463373
Sequence CCATATTGATAGTCATGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953380069_953380075 10 Left 953380069 3:42463318-42463340 CCATTGCAGAGGTACAAAGTCCA No data
Right 953380075 3:42463351-42463373 CCATATTGATAGTCATGCCCGGG No data
953380071_953380075 -10 Left 953380071 3:42463338-42463360 CCAGGTCCAACATCCATATTGAT No data
Right 953380075 3:42463351-42463373 CCATATTGATAGTCATGCCCGGG No data
953380067_953380075 23 Left 953380067 3:42463305-42463327 CCAAAGTCAGGGTCCATTGCAGA No data
Right 953380075 3:42463351-42463373 CCATATTGATAGTCATGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953380075 Original CRISPR CCATATTGATAGTCATGCCC GGG Intergenic
No off target data available for this crispr