ID: 953383732

View in Genome Browser
Species Human (GRCh38)
Location 3:42492943-42492965
Sequence GCAGAACCAGCAACCAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953383719_953383732 29 Left 953383719 3:42492891-42492913 CCCAGACCCTGAACTTGCCAGGA 0: 1
1: 0
2: 1
3: 23
4: 191
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383721_953383732 23 Left 953383721 3:42492897-42492919 CCCTGAACTTGCCAGGACCATGC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383720_953383732 28 Left 953383720 3:42492892-42492914 CCAGACCCTGAACTTGCCAGGAC 0: 1
1: 0
2: 6
3: 57
4: 330
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383722_953383732 22 Left 953383722 3:42492898-42492920 CCTGAACTTGCCAGGACCATGCA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383727_953383732 6 Left 953383727 3:42492914-42492936 CCATGCAGGCTGGGCTACTGTGG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383726_953383732 12 Left 953383726 3:42492908-42492930 CCAGGACCATGCAGGCTGGGCTA 0: 1
1: 0
2: 0
3: 13
4: 172
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127
953383717_953383732 30 Left 953383717 3:42492890-42492912 CCCCAGACCCTGAACTTGCCAGG 0: 1
1: 0
2: 0
3: 27
4: 304
Right 953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953383732 Original CRISPR GCAGAACCAGCAACCAATGG AGG Intronic
900718046 1:4157677-4157699 GCACAGCCAGCACCCAGTGGAGG + Intergenic
902180012 1:14680881-14680903 GCAGAACCAGGAGCCAATGAAGG - Intronic
902855729 1:19203192-19203214 GCAGAAGTATCAACCTATGGTGG + Intronic
905878530 1:41448754-41448776 TCAGAAGCAGCAAGGAATGGAGG + Intergenic
909387627 1:75077824-75077846 GCAGAACTAGCAAGCAATTTGGG + Intergenic
909639232 1:77853418-77853440 GCAGAAACTACAACCAAAGGAGG + Intronic
910966048 1:92809049-92809071 GCAGAACAAGCAACTCATAGTGG + Intergenic
912472648 1:109916181-109916203 GCAGAACCAGCAGCACTTGGTGG - Intronic
920455915 1:206101006-206101028 GCAGAGCCAGCAACAAAAAGGGG - Intronic
920584059 1:207140185-207140207 GGAGAACCAGCATCAAATGCTGG - Intronic
920590871 1:207217302-207217324 GCAGCACCAGCAGCAACTGGAGG + Intergenic
923788076 1:237087171-237087193 GAAGCACCAGCAACTAATGAGGG - Intronic
924824794 1:247528040-247528062 GAAGAAACAGAAACAAATGGGGG - Intronic
1066625386 10:37400827-37400849 GCAGAAACAGAAACTAAGGGTGG - Intergenic
1067460247 10:46452842-46452864 GCAGAAACAGCATCCAATTCAGG - Intergenic
1067626943 10:47931761-47931783 GCAGAAACAGCATCCAATTCAGG + Intergenic
1067709080 10:48634467-48634489 GCAGAAACAGAAACCATTGTAGG + Intronic
1068507811 10:57925032-57925054 ATAGAAACAGCAAGCAATGGAGG - Intergenic
1068766874 10:60773945-60773967 TCAGAGCCAGCAGACAATGGAGG - Intergenic
1071113118 10:82185687-82185709 GCAGAAGCAGAAACCTAGGGTGG + Intronic
1071744335 10:88398750-88398772 ACAGAACAAACAACCAAAGGGGG + Intronic
1071753313 10:88506199-88506221 GCAGAGCCAGGAAGAAATGGTGG + Intronic
1073864246 10:107784260-107784282 GCAGCACCAGCAATCAGAGGGGG - Intergenic
1074298216 10:112210489-112210511 CCATGACCAGCAAACAATGGGGG + Intronic
1075231694 10:120685364-120685386 GCAGAATCAACATCCAAAGGAGG - Intergenic
1075953546 10:126503292-126503314 GCAGAAACAGCAACAAATCCTGG + Intronic
1081625225 11:44651461-44651483 GCAGAAGAAGCAGACAATGGTGG + Intergenic
1096357022 12:50949842-50949864 GCAGAACCACCACCCAAGGCAGG + Intergenic
1097679092 12:62632388-62632410 GCCGAACCAGCTACCAATAAAGG - Intergenic
1098621826 12:72610640-72610662 GCAGAAGCAGGAACCACAGGTGG + Intronic
1099709330 12:86200971-86200993 GCTTAACCAGAAACCAATTGTGG + Intronic
1102579330 12:113876222-113876244 GCAGAATCTGCAACCTATGCTGG + Intronic
1105310502 13:19204401-19204423 GCAGGACCAGGACCCATTGGTGG + Intergenic
1105360207 13:19705723-19705745 GCAGGACCAGGACCCATTGGTGG + Exonic
1105877387 13:24570649-24570671 GCAGGACCAGGACCCACTGGTGG - Intergenic
1108204363 13:48072871-48072893 GGAAAACCAGCAGCCACTGGAGG - Intronic
1108724710 13:53167429-53167451 GCAGTACCAGCAACCAAGGTGGG - Intergenic
1108822832 13:54374810-54374832 CCTGATCAAGCAACCAATGGTGG + Intergenic
1113641824 13:111963130-111963152 GCTGGACCAGGAACCCATGGAGG - Intergenic
1119484655 14:74979718-74979740 GCAGAGCCAGCTCCCACTGGTGG - Intergenic
1120372021 14:83648017-83648039 GCAGAACCAGAAATCAGAGGAGG - Intergenic
1121001453 14:90454489-90454511 GCAGGACCGGCAGCCAATGAAGG + Intergenic
1123001048 14:105294241-105294263 GCAGGCCCAGCAACCAACTGTGG - Intronic
1124050431 15:26192125-26192147 GCAGAACCTGCAAATAATGATGG - Intergenic
1125984263 15:44034492-44034514 GCAGAAGCAGAAACTAATGCAGG - Intronic
1135668143 16:24352896-24352918 GCAGAACATGGAACCAAGGGTGG - Intronic
1144005984 17:11099970-11099992 GTAGCACTAGCAATCAATGGAGG - Intergenic
1145829845 17:27907079-27907101 GAAAAACCAGCAACCAAGGCGGG + Intergenic
1148473959 17:47914894-47914916 GGAGAAGCAGCAACAAATAGAGG + Intronic
1154217011 18:12422903-12422925 GCAGAACCAGTAAATAGTGGTGG - Intronic
1158891222 18:61873691-61873713 GCAGAAAAAGAAACAAATGGTGG - Intronic
1163989239 19:20983003-20983025 GCAGAACCTGAAACCAAGGAAGG + Intergenic
1166503958 19:43360075-43360097 GCAGAAACAGGGAACAATGGGGG + Intronic
1166506501 19:43374683-43374705 GCAGAAACAGGGAACAATGGGGG - Intergenic
1168351863 19:55680557-55680579 GCACAAGCAGCAACCAAAGCAGG - Intronic
1168518820 19:57032222-57032244 ACAGAACCAGCTATCAATGTGGG - Intergenic
926932588 2:18055237-18055259 CCATAACCAGCAAGGAATGGAGG - Intronic
928409938 2:31047233-31047255 TCAGACCCAGCAAGCCATGGTGG + Intronic
932002898 2:67900736-67900758 GCAGGACCAGGAACCAGAGGAGG + Intergenic
932023191 2:68108943-68108965 GCAGAACAAACAAATAATGGTGG - Intronic
932062139 2:68513659-68513681 TCAGTACCAGCAATCAGTGGAGG + Exonic
933970935 2:87469241-87469263 GCAGAGCCAGCAAACAAGTGGGG + Intergenic
936322792 2:111480948-111480970 GCAGAGCCAGCAAACAAGTGGGG - Intergenic
936479328 2:112870532-112870554 GAGGAACCATTAACCAATGGGGG - Intergenic
936654455 2:114468529-114468551 GCAGAAACAGTTACAAATGGTGG + Intronic
940106258 2:150104287-150104309 GCAGAAGCAGCAAGCACTGATGG - Intergenic
940518175 2:154708020-154708042 GCAGCTCTAGCAACCAATGTTGG - Intronic
943113182 2:183632890-183632912 GAATAAACAGCAACCAATGTGGG + Intergenic
947473713 2:230422303-230422325 CCAGAACAAGCAAATAATGGAGG - Intronic
947586859 2:231361827-231361849 GCAGAACCTGCACCCACTGGTGG + Intronic
948517437 2:238512468-238512490 GGAGAACCAGCACCCAGTGAGGG + Intergenic
1170375717 20:15698464-15698486 GCAGCACCAGTAACCCATGAAGG - Intronic
1170765051 20:19282752-19282774 GCAGAACCAGCAAGGATGGGGGG + Intronic
1170797889 20:19565541-19565563 GAAGAAGCAGCAGCCAATGAGGG - Intronic
1171885790 20:30651782-30651804 GCAGAACCTGCACCCAGTCGTGG + Intergenic
1171952840 20:31436817-31436839 TCAGAACCAGCATCTAATAGGGG + Intergenic
1172797992 20:37556508-37556530 GCAGAAGCAGCACCTGATGGTGG - Intergenic
1173410806 20:42808053-42808075 GCACATCCAGCAACTGATGGAGG + Intronic
1174138639 20:48397890-48397912 GCAGCACCAGCAGCCACAGGAGG + Intergenic
1174978688 20:55365371-55365393 GCAGAAACAACAACCAATGTAGG - Intergenic
1175908961 20:62395571-62395593 GCAGAGCCAGCGTCCAAGGGAGG - Intronic
1177214275 21:18108272-18108294 TCTGAACCAGCAACCAATTTAGG + Intronic
1179122618 21:38562439-38562461 GCAGAACCAGCAGCACCTGGGGG + Intronic
1182748442 22:32623519-32623541 GCACTTCCAGCAATCAATGGCGG + Intronic
952416802 3:33097040-33097062 GCAGAACCAGCAACAGAGGGAGG + Exonic
953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG + Intronic
953553812 3:43926136-43926158 CCAGGACAACCAACCAATGGTGG - Intergenic
953916025 3:46921841-46921863 GCAGAACCAGCAACAACTCTGGG - Exonic
953918576 3:46936513-46936535 GCAGAATCTTCAACCAAAGGTGG - Intronic
954104268 3:48401011-48401033 TCAGAAGCAGCTACCAATGAGGG - Intronic
954231407 3:49220579-49220601 GCAGACCCAGCCAGCCATGGTGG + Intronic
959403546 3:105932713-105932735 GCAGACCCAGCAACCACGGCAGG - Intergenic
960687419 3:120307928-120307950 GCAGCAGCAGCAAGGAATGGAGG + Intergenic
963103022 3:141623628-141623650 TCAGAACCAGCAGCCACAGGCGG - Intergenic
963455970 3:145548473-145548495 AAAGAACGAGCAACAAATGGTGG - Intergenic
967089654 3:186124825-186124847 GCAGGACCAGCCACCAAAGACGG + Intronic
967936992 3:194736887-194736909 GCAGAAGCAGCAAGCACAGGAGG - Intergenic
968059251 3:195714483-195714505 AGGGAACCAGCAACCAGTGGTGG - Intergenic
973222124 4:47738561-47738583 ACAGAAACAGCAACTAATGTTGG + Intronic
973227488 4:47802479-47802501 CCACAACCACCAACCCATGGGGG - Intronic
974261782 4:59534454-59534476 GCTAAACGAGCAACCAAAGGAGG - Intergenic
975490006 4:74977473-74977495 GCTGAACCTACAACTAATGGGGG + Intronic
977402385 4:96548497-96548519 GCAGAACCATCAATCAAGAGGGG - Intergenic
979054985 4:115981530-115981552 ACAGAACAAGTAACAAATGGAGG + Intergenic
979559554 4:122086937-122086959 GCAGAGCCAGAAAATAATGGTGG + Intergenic
982141102 4:152319094-152319116 GCAGAACCCACAAATAATGGAGG - Intergenic
982349515 4:154399710-154399732 GCAGAATCCGAAACCAATGTTGG + Intronic
982519710 4:156399100-156399122 GCAGAATCAGGAAACAATAGAGG + Intergenic
982899486 4:160980591-160980613 CCACCACCAGCAGCCAATGGAGG + Intergenic
985807893 5:2060529-2060551 GCAGAGCCTGCAAGGAATGGAGG + Intergenic
986707384 5:10463329-10463351 GCAGAGTCAGCACCCAATGATGG - Intronic
987329459 5:16843043-16843065 GCAGAACCAGAAACCATAGCAGG - Intronic
988634353 5:32966664-32966686 CCAGAACCAGCATACAATAGAGG + Intergenic
989433631 5:41384838-41384860 GCAGAAGGAGAAACCAATGGTGG + Intronic
991454085 5:66783874-66783896 CCAGAACCAGCACCCATTGCTGG - Intronic
992804218 5:80321346-80321368 GCAGAACAAGCAAGCAATGAAGG + Exonic
1003218163 6:4134397-4134419 GCAGAAACAGCAACCACCGCGGG + Intronic
1004785017 6:18958434-18958456 GCAGAGCCAGCAAAAGATGGTGG - Intergenic
1010445334 6:75943202-75943224 GCAGTACGAGCTACCATTGGGGG - Intronic
1017852936 6:158321278-158321300 GCAGAGCCAGCAAAGAAAGGCGG - Intronic
1017940350 6:159047377-159047399 GCAGCACCAGCCAACAATGGTGG - Intergenic
1022382905 7:29876843-29876865 GCAGAACCAGAACTCAATGTGGG - Intronic
1026977347 7:74506733-74506755 GTAGAACCAGGAGCCAAAGGAGG + Intronic
1030360066 7:108586468-108586490 CGAGAAAAAGCAACCAATGGAGG - Intergenic
1041436263 8:57845555-57845577 GCAGAACCACCAAGCAATACAGG + Intergenic
1049311345 8:141935472-141935494 GCAGAGCCAGCAGCCCATGGTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058070920 9:100599714-100599736 GCTGAACCCGCAACCAAAGGAGG - Intergenic
1186525604 X:10245220-10245242 ACAGCACCAGCTGCCAATGGGGG + Intergenic
1187941893 X:24390691-24390713 GCAGAGCCAGCAATCAATCCAGG - Intergenic
1188387381 X:29577767-29577789 GCAGAACCAGCAATACTTGGAGG - Intronic
1188604492 X:32011629-32011651 GCAGGACCTGCAACCACAGGAGG - Intronic
1189097587 X:38156737-38156759 CCAGAACCAGAAATGAATGGTGG + Intronic
1192981819 X:76351994-76352016 GCAGATGCAATAACCAATGGTGG - Intergenic
1194033094 X:88839833-88839855 CCAGAACCAGCAGACTATGGAGG + Intergenic
1194526527 X:94983878-94983900 CCACAACCACCAACCCATGGAGG - Intergenic
1194659223 X:96610395-96610417 GAAGAAAAAGCAACCTATGGGGG - Intergenic
1195669929 X:107461045-107461067 GCAGACCCAACAGCCAATGCTGG - Intergenic