ID: 953383820

View in Genome Browser
Species Human (GRCh38)
Location 3:42493463-42493485
Sequence CTGTGGGCACAGTTGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953383820 Original CRISPR CTGTGGGCACAGTTGGGCCT AGG Intronic
900186872 1:1336870-1336892 CCGGGGGGACAGTGGGGCCTTGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900963252 1:5939449-5939471 ATGTGGGCACTGCAGGGCCTGGG + Intronic
901028220 1:6290473-6290495 CTGAGGGCACAGCAGGGCCATGG - Intronic
901666977 1:10831647-10831669 CTGTGGGCCCAGTGGGCCCTGGG + Intergenic
902040299 1:13487501-13487523 CTGTGGGCCCTGTTCTGCCTAGG - Intronic
902744447 1:18464114-18464136 CTGTGGTCAATGTTGGCCCTGGG + Intergenic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903180432 1:21602430-21602452 GGGTGGCCACAGATGGGCCTGGG - Intronic
903322612 1:22551992-22552014 CTGAGGGCAGGGTGGGGCCTTGG + Intergenic
903648056 1:24906459-24906481 CTGTGTGCACAGCCGGCCCTTGG - Intronic
904018788 1:27445344-27445366 GTTTGGACACAGTTGGACCTGGG - Intronic
904207476 1:28864381-28864403 CGGTGGCCACAGTGGGGCTTGGG + Intergenic
905890178 1:41513772-41513794 CCAAGGTCACAGTTGGGCCTTGG + Intronic
906297982 1:44660615-44660637 CAGTGGGCTCAGTTTGGCCCCGG - Intronic
908509994 1:64843957-64843979 CTGTGGGAAGAGATGGGCATGGG - Intronic
908758432 1:67490349-67490371 ATGTGGGCACAGTTGGAGATAGG - Intergenic
912518585 1:110230620-110230642 CGGTGGGCACAGATGTCCCTGGG + Intronic
912800489 1:112716807-112716829 CTGGGGACACAGTTTAGCCTGGG - Intergenic
913164035 1:116168831-116168853 CTGCGGCCACAGTTGGCCCCAGG + Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
915544938 1:156591814-156591836 CTGCGGGCGCTGCTGGGCCTCGG + Exonic
917592804 1:176494617-176494639 CTGAGGGCAGATTTTGGCCTGGG + Intronic
919838991 1:201595590-201595612 CTGGGGGCATAGTGGGGCCAGGG + Intergenic
922932887 1:229403883-229403905 CTGTGGGCACACCTGCCCCTCGG + Intergenic
923436558 1:233972920-233972942 CAGTGGGCTCAGGTGGCCCTGGG - Intronic
923604855 1:235433967-235433989 CTGTGGGCACTTTGAGGCCTTGG - Intronic
1063752487 10:8966411-8966433 CTGTGAGAACAGTTGGACATGGG - Intergenic
1064179549 10:13102278-13102300 CTGGTGGGTCAGTTGGGCCTGGG + Intronic
1064635745 10:17364730-17364752 CTGTGGGCCAAGTTGGGGATAGG + Intronic
1067067098 10:43110402-43110424 CTGTGGTCACTTGTGGGCCTGGG + Intronic
1067282301 10:44881608-44881630 CCCTGGTCACACTTGGGCCTGGG - Intergenic
1067342825 10:45418702-45418724 CTGTGGGCACAGGTGTGGCGAGG + Intronic
1069709723 10:70480493-70480515 GGGTGGGCACAGTAGGGCCCAGG + Intronic
1070289124 10:75103464-75103486 CTCAGGGGACAGTGGGGCCTGGG - Intronic
1071745297 10:88411978-88412000 ATGTGGGCAGAGATGAGCCTGGG + Intronic
1071941118 10:90593024-90593046 CTGTGGGCATAGGCTGGCCTGGG - Intergenic
1072537885 10:96377099-96377121 CAGTGGGGTCAGGTGGGCCTCGG + Intronic
1073203124 10:101752479-101752501 CTGTGGCCACTGGTGGCCCTAGG + Intergenic
1073268511 10:102242456-102242478 CTGTGGGCAAGGTGTGGCCTTGG + Intergenic
1073510128 10:104037711-104037733 CTGGGGGACCAGGTGGGCCTGGG + Exonic
1073510625 10:104040369-104040391 CTGGGGGGCCAGGTGGGCCTGGG + Exonic
1073528283 10:104206792-104206814 CTGTGGCCATGGTTGGGCCTGGG - Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075489993 10:122858595-122858617 CTGTGGGCACAGGTGTGTATGGG - Intronic
1075788828 10:125068881-125068903 CTGAGGGGAGAGTGGGGCCTCGG - Intronic
1075927181 10:126261209-126261231 GTGTGTGCACAGTCGTGCCTTGG - Intronic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076578947 10:131494063-131494085 CTGTGGCCTCAGTTGTACCTGGG - Intergenic
1076801947 10:132835011-132835033 CTGTGGGGACAGCCGGGCCCAGG + Intronic
1078025908 11:7695455-7695477 ATGTGGAGTCAGTTGGGCCTTGG + Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1080708486 11:34722158-34722180 CAGAGGGAACAGTTGAGCCTAGG + Intergenic
1081814130 11:45929176-45929198 CTGGGGTCACAGGAGGGCCTGGG + Intergenic
1083278180 11:61609207-61609229 CTGTGGACACAGTGAGGCCCCGG - Intergenic
1083457625 11:62789532-62789554 CACTGGGCACAGGTGTGCCTCGG + Intronic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1084534454 11:69748455-69748477 CTGTGGGCACCGGGAGGCCTGGG + Intergenic
1084661504 11:70549122-70549144 CCGTGTGCACAGCTGTGCCTGGG - Intronic
1084891306 11:72238400-72238422 CTGGGGCCATAGCTGGGCCTTGG - Exonic
1085277316 11:75308343-75308365 CTCTGGGCTCGCTTGGGCCTTGG - Intronic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089109910 11:116047203-116047225 CTGTGTGCAGCGTGGGGCCTGGG - Intergenic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089402553 11:118172714-118172736 CTGAGGGCCCAGATGTGCCTTGG - Intronic
1089519886 11:119056711-119056733 CTGTGGGCACAGCGGGGCCGGGG - Intronic
1089579183 11:119470863-119470885 CTGTGCCCACAGCTGGGCCGGGG + Intergenic
1090226440 11:125074803-125074825 CTGGGGCCCCAGTGGGGCCTTGG + Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1092160001 12:6310837-6310859 CTGTGGGCACAGGTGAGCGGCGG + Intronic
1096553222 12:52387983-52388005 CTGTGGGAAGAGATGGGCCTGGG - Intergenic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1099707836 12:86180056-86180078 CTGTGTGCACCCTTGGGACTTGG + Intronic
1100042126 12:90332640-90332662 CTGTGGTCATACCTGGGCCTAGG + Intergenic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101951288 12:109177922-109177944 CTGTGTGCACATGAGGGCCTGGG - Intronic
1103548324 12:121717587-121717609 CTCAGGGCACAGATGAGCCTAGG - Intronic
1103703779 12:122860817-122860839 CTCTGGGCCCAGCTTGGCCTGGG + Intronic
1104733945 12:131124565-131124587 CTGTGGGGCCTGCTGGGCCTAGG + Intronic
1104810930 12:131620045-131620067 CTGAGGGCAGGGTTGAGCCTGGG - Intergenic
1104967902 12:132517579-132517601 GTGTGAGCACAGCTGTGCCTGGG + Intronic
1104975968 12:132552117-132552139 ATGGGGCCACAGTGGGGCCTGGG + Intronic
1105008704 12:132739793-132739815 CTGTGGTCACGCTGGGGCCTCGG - Intronic
1106419278 13:29572219-29572241 CTCTGGGCACAGATGTGACTTGG - Intronic
1106442228 13:29786138-29786160 CTGTGGGCTCAGATGCACCTGGG - Intronic
1112569262 13:100579311-100579333 CTGTGGGGAGAGGAGGGCCTAGG + Intronic
1113237983 13:108302784-108302806 CTGTTGCCACATTTGGGCCAAGG + Intronic
1113961380 13:114128168-114128190 GTGTGGCCACACATGGGCCTTGG - Intronic
1114734721 14:25032584-25032606 CTGTGGTGACAGTTGGCTCTTGG - Intronic
1118407694 14:65442776-65442798 CAGTGAGCCAAGTTGGGCCTGGG + Intronic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122603690 14:102933761-102933783 CTGTGGGGGGAGTTGGGGCTCGG + Exonic
1122719662 14:103715263-103715285 CTGTGGGAGCAGGCGGGCCTGGG - Intronic
1123410693 15:20056462-20056484 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1123520022 15:21063168-21063190 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1123847927 15:24323186-24323208 CAGAGGGCACAGTTGGGCTAGGG + Intergenic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1127310092 15:57744818-57744840 CTGAAGGCACAGTTTTGCCTTGG + Intronic
1127398560 15:58563176-58563198 CTGTGGAGACAGTGGGGCTTTGG - Intronic
1128251285 15:66165884-66165906 CTGTGGGCACGGTCTGTCCTGGG - Intronic
1128341819 15:66827612-66827634 TCGTGGGCTCAGATGGGCCTGGG + Intergenic
1129329696 15:74820695-74820717 CTGTGGGCAAGGCTGGGCTTGGG + Exonic
1130854216 15:87826643-87826665 CTGATGGCACAGTTGAGCATGGG + Intergenic
1131408323 15:92184788-92184810 CTGTGGTCTCTGTTGGGTCTAGG + Intergenic
1132305295 15:100807654-100807676 CTTTGGGCACTGTTGAGCATAGG + Intergenic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1134442395 16:14307085-14307107 CTGAGGCCACATCTGGGCCTCGG - Intergenic
1135302022 16:21338635-21338657 GTGTGGGGCCAGATGGGCCTCGG + Intergenic
1137038923 16:35591854-35591876 CTGTGGGCCGAGCTGGGACTTGG + Intergenic
1140485497 16:75290078-75290100 CTGAGGGCACAGATGGGCTCAGG + Intergenic
1141164051 16:81648450-81648472 CTGTGGGATCACTTTGGCCTGGG + Intronic
1141634727 16:85308077-85308099 CTGTGGGCAAAGGAGGGACTTGG + Intergenic
1142006669 16:87692555-87692577 CACTGGCCACAGATGGGCCTGGG + Intronic
1142006682 16:87692599-87692621 CACTGGCCACAGATGGGCCTGGG + Intronic
1142258060 16:89024851-89024873 CTGTGTGCACAGGTGGGCCTCGG - Intergenic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148226307 17:45900136-45900158 CTTTTGGCAAAGATGGGCCTGGG + Intronic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1151473089 17:74330048-74330070 CTGTGGGCACAGTAGAGCCATGG + Intronic
1152355850 17:79806814-79806836 AGGTGGGCACAGGTGGGCATGGG + Intergenic
1152587360 17:81195033-81195055 CTGTGGGCACAGTCAGGGCCGGG + Intronic
1152825425 17:82461869-82461891 CTGTGGGGACTGTGGGGCTTAGG + Intronic
1152930771 17:83108522-83108544 GTGTGGGCACTGGTGGGCGTAGG + Intergenic
1152976717 18:228180-228202 CTGTGGCCACAGCTAGACCTGGG + Intronic
1154486702 18:14877672-14877694 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1156742565 18:40350077-40350099 CTGTGGGCCCAGTGGGCCATAGG - Intergenic
1157006470 18:43589854-43589876 CTTTGGGCACAGATGAGCATGGG - Intergenic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1158259403 18:55590290-55590312 CTCTGGGCCAAGTTGGTCCTAGG + Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159995768 18:74962492-74962514 CTGTGGGAATGGATGGGCCTAGG + Intronic
1160567700 18:79797726-79797748 CGGTGTGCAGAGTGGGGCCTGGG + Intergenic
1160902158 19:1434006-1434028 ACGTGGGCACAGGTGGGCGTGGG - Intronic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161346768 19:3772131-3772153 GGGTGGGCACTGGTGGGCCTGGG - Intronic
1161454543 19:4363474-4363496 CTGTGGGGACAGTAGGGCTCAGG + Intronic
1161572024 19:5036013-5036035 CTGTGGGGACAGATGGGCTCAGG + Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1165490839 19:36121776-36121798 TTGGGGGCACAGTGGAGCCTCGG + Intronic
1165899887 19:39164400-39164422 TTGTGAGCACAGGCGGGCCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166292453 19:41871821-41871843 CTGTGACCTCAGCTGGGCCTGGG + Exonic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166998086 19:46729361-46729383 CAGTGGGCAGAGCTTGGCCTTGG - Intronic
1167019676 19:46863757-46863779 TTATGGCCACAGTTGGACCTAGG + Intergenic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
925943812 2:8842595-8842617 CGGTGGGCAGAGCTCGGCCTGGG - Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926333709 2:11847746-11847768 CTGTGAGGGCAGTTGGGCCTTGG + Intergenic
927208462 2:20624555-20624577 CTGTGGGCAGATGTGGGCCCTGG - Intronic
927211571 2:20642178-20642200 CTGTGGGCACAGTCCGGGCCTGG - Intronic
927442620 2:23129976-23129998 CCTTGGGCACAGTTGGGTATAGG - Intergenic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
928592712 2:32833930-32833952 CTATGGGGACAGTTGGCCCAAGG - Intergenic
928854439 2:35787986-35788008 CTCTGGGCACAGGTGAGCCTGGG - Intergenic
931944046 2:67285333-67285355 CTGTGGGCACAGTGGTTCCTAGG + Intergenic
932702167 2:73999633-73999655 CTGGGAGCACAGTAGGGTCTGGG + Intronic
934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG + Intergenic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934224995 2:90124714-90124736 CTGTACCCACAATTGGGCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934662400 2:96150171-96150193 CTGTGTTCCCAGATGGGCCTGGG + Intergenic
936064360 2:109319376-109319398 CTGTGGGCTCAGTGGGGTCCCGG + Intronic
936558401 2:113515586-113515608 CTGTGGGCAGAACTGGGCCGTGG + Intergenic
937064150 2:119004632-119004654 CTGTGGGCACAAGTGAGCCATGG + Intergenic
937875721 2:126823960-126823982 CTGTGGCTACAGATGAGCCTTGG + Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
944709411 2:202322295-202322317 TTGGGGGCACAGTTTGGACTAGG - Intergenic
946204012 2:218090196-218090218 CTGTGGGCAGAGTAGGGTGTGGG + Exonic
946575586 2:221071929-221071951 CTGTGTGCACCTTTGGGACTTGG - Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948581983 2:238993845-238993867 CTGTGGGCACAGTTGACTTTGGG - Intergenic
948807866 2:240460757-240460779 GTAGGGGCACAGGTGGGCCTTGG - Intronic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
1171036045 20:21713805-21713827 CTGTGGGCACAGCACGTCCTGGG - Intronic
1172633451 20:36393933-36393955 CTGTGTGTACAGCAGGGCCTGGG - Intronic
1174398347 20:50261532-50261554 CTGTGGGGTCAGATGGGCTTGGG + Intergenic
1174406933 20:50308885-50308907 TTGTGGGCAAGGCTGGGCCTGGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1176191911 20:63815456-63815478 CAGTGGGTACAGGTGGGCATAGG + Intronic
1176191945 20:63815633-63815655 CAGTGGGTACAGGTGGGCATAGG + Intronic
1176191972 20:63815794-63815816 CAGTGGGTACAGATGGGCATAGG + Intronic
1176192009 20:63815990-63816012 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176192029 20:63816070-63816092 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176553692 21:8243329-8243351 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176572614 21:8426353-8426375 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176580523 21:8470914-8470936 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176794600 21:13361727-13361749 CTGAGGTCACAGGTGGGACTGGG - Intergenic
1177007877 21:15696543-15696565 CTGTGGGCTCAGTTAGGGCCTGG - Intergenic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1179509246 21:41861542-41861564 CGGTGCGCACAGTTGGGGATTGG - Exonic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1179732174 21:43374094-43374116 CTCTGGGCACAGGAGGGCCAAGG - Intergenic
1179791249 21:43757224-43757246 CTCTGGGCAAAGTGGGGCCAGGG - Exonic
1180181664 21:46120968-46120990 CTGTGGACACTGCAGGGCCTCGG - Intronic
1180591024 22:16937474-16937496 CAGTGGCCACAGTTCAGCCTTGG + Intergenic
1180593234 22:16957917-16957939 CTGTGGTGACAGCTGGTCCTGGG - Intergenic
1181179283 22:21055653-21055675 CTGTGGGCACAGTGGTCCCCTGG - Intronic
1181506499 22:23361819-23361841 CTGTGGGCACCACAGGGCCTTGG + Intergenic
1181776230 22:25161770-25161792 GTGTGGTCTCAGTTGGGCCCAGG - Intronic
1182284140 22:29234142-29234164 CTTTGGGTCCAGTGGGGCCTGGG - Exonic
1183000799 22:34857024-34857046 CTCAGGCCACAGTAGGGCCTTGG + Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
1184682689 22:46080449-46080471 CAGTGGGCCCGGCTGGGCCTCGG - Intronic
1185404070 22:50635880-50635902 CGGGGGGCACAGCTGGGCCAGGG - Intergenic
1203258696 22_KI270733v1_random:160361-160383 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
949935534 3:9112866-9112888 CTGTGTGCCCAGGTTGGCCTGGG - Intronic
950440465 3:13007374-13007396 CTGTGGGCCCAGCTGCCCCTGGG + Intronic
950669873 3:14519601-14519623 CAGAGGGCACAGTTGGGGCCAGG - Intronic
952205908 3:31181468-31181490 CTGTGGGCTGAGCTGTGCCTGGG - Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
954135436 3:48580122-48580144 TTGGGGGCAGAGTTGAGCCTGGG - Intronic
954407448 3:50353358-50353380 CTGTGTGCACTGCTGGGCCTCGG + Exonic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954455671 3:50598480-50598502 CTGTGGGCACACTGGAGCATAGG - Intergenic
955509494 3:59665162-59665184 CTCTGGACAGAGTTAGGCCTGGG + Intergenic
956779624 3:72593750-72593772 CTGTGGGAACAGTGGTGCCCAGG + Intergenic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
961651848 3:128420838-128420860 GAGGGGGCACAGTGGGGCCTGGG - Intergenic
968486730 4:866535-866557 CTGTGGGGACAGGCGGGCATGGG + Intronic
968648369 4:1750780-1750802 CTGTGGGCACAGGGGGGTCGGGG - Intergenic
968654319 4:1772045-1772067 CTGTGTGCACAGAGGGGCCGGGG - Intergenic
969456419 4:7302396-7302418 CTGTGGGCACACTCCTGCCTCGG + Intronic
970211035 4:13710225-13710247 CTGTGGGTAAGGTTGAGCCTGGG + Intergenic
970681475 4:18513418-18513440 CTTTGGGCATTGTTGGACCTAGG + Intergenic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985058402 4:186056043-186056065 TTGAGGGCATTGTTGGGCCTGGG - Intergenic
985555387 5:555525-555547 CTGGGGGCAGAGTTGGGCAGCGG - Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
989141324 5:38204436-38204458 CTGTGGGTACAGTCATGCCTAGG + Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
994787746 5:104186401-104186423 CTCTGGGCACAAGTGAGCCTGGG - Intergenic
996300002 5:121970317-121970339 CAGTGGGTAGAGTTGGTCCTTGG - Intronic
996457090 5:123697093-123697115 CTGGGCTCCCAGTTGGGCCTGGG + Intergenic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998796227 5:145822152-145822174 CTTTGGGGACACTGGGGCCTAGG - Intronic
1001299009 5:170520322-170520344 CTAAGGGCACAGACGGGCCTGGG - Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1002132972 5:177092604-177092626 CTGGGGTCACAGCAGGGCCTGGG - Intronic
1003355437 6:5365097-5365119 CTGTGGGCAGATTTGGCCCTTGG + Intronic
1007177715 6:39908156-39908178 CAGTGGGCAAAGATGGTCCTTGG + Intronic
1009266044 6:61556043-61556065 CTGGGGCCACTGGTGGGCCTAGG + Intergenic
1011019052 6:82789925-82789947 CAGTGGTCACTGTGGGGCCTTGG + Intergenic
1014581116 6:123138203-123138225 CTGTGTGCAAACTTGGGACTTGG + Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1018010382 6:159664793-159664815 CTTTTTGCACATTTGGGCCTTGG - Intergenic
1018795147 6:167179763-167179785 CTGTGGGCACAACTCGCCCTGGG + Intronic
1018821171 6:167375299-167375321 CTGTGGGCACAACTCGCCCTGGG - Intronic
1019067865 6:169317631-169317653 CTTTGGGTAAAGTTGGGCTTTGG + Intergenic
1020431262 7:8118758-8118780 CTCTGGGGACAGGTGGGTCTTGG - Intronic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1022949907 7:35328248-35328270 CTGTGGGCACAACTGTGCCTTGG - Intergenic
1023387201 7:39670928-39670950 CTGTGGGACCAGTTGGGAGTAGG - Intronic
1023558948 7:41452428-41452450 ATGTGGACACACTGGGGCCTCGG - Intergenic
1029510848 7:100994055-100994077 CTGTGGTTTCAGTTGAGCCTCGG - Exonic
1029511341 7:100997304-100997326 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029511567 7:100998726-100998748 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029512065 7:101001975-101001997 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029512527 7:101005131-101005153 CTGTGGTTTCAGTTGAGCCTGGG - Exonic
1029587729 7:101486238-101486260 CTCTGGGCATAGTTGACCCTTGG + Intronic
1030365190 7:108637616-108637638 CTGTGGGCCCAGCAGGGCCATGG + Intergenic
1030881975 7:114891247-114891269 TTGTGAGTACAGTTGGTCCTTGG + Intergenic
1031985952 7:128164871-128164893 CTGTGGGCCCAGATGAGACTGGG + Intergenic
1033621256 7:143063710-143063732 CTGTGTGCACAGTTGACCCCAGG + Intergenic
1033740640 7:144273044-144273066 CTCTGTGCCCAGTTGTGCCTAGG + Intergenic
1033753267 7:144376569-144376591 CTCTGTGCCCAGTTGTGCCTAGG - Intronic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1034874547 7:154713664-154713686 CTGTGTGCAGACTTGGGACTTGG - Intronic
1035023941 7:155814629-155814651 TTGTGGGCACAGCTGGACGTGGG + Intergenic
1035477032 7:159151111-159151133 CTGTGGCCACAGCTGTGTCTCGG + Intergenic
1035931815 8:3788354-3788376 CTGTGGGCACAGGGAGGCATGGG - Intronic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1038780993 8:30568432-30568454 ACGTGGGGACAGATGGGCCTGGG - Intronic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1040581684 8:48703794-48703816 CTGTGGGCACAGGTGAGACCTGG + Intergenic
1041388729 8:57330436-57330458 CTGGGAGCAGAGGTGGGCCTTGG - Intergenic
1044627906 8:94252245-94252267 CTGTGAGTTCAGTTAGGCCTGGG + Intronic
1046831167 8:118748086-118748108 CAATGGGCAGAGTTGGGCCATGG + Intergenic
1047171447 8:122497111-122497133 CTGTGGGGAAGGTTGGGGCTGGG - Intergenic
1047576248 8:126158969-126158991 CTGTGGGAAGAGTTGGGCGGTGG - Intergenic
1047746473 8:127848788-127848810 CTGTGGGAACAGTTGTGCTCAGG + Intergenic
1049437948 8:142596296-142596318 CTCTGGGCACGGAGGGGCCTTGG - Intergenic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049675210 8:143886166-143886188 TGGTGGGCACAGGTGGGCTTTGG - Intergenic
1050486763 9:6142628-6142650 CTGTGGCCACAGCTAGGACTTGG + Intergenic
1052833962 9:33236543-33236565 ATGTGGGCAAAGTGGGGCCAGGG - Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1053887635 9:42656449-42656471 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1054226657 9:62463899-62463921 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054766855 9:69049154-69049176 CTGCCGGCAGAGTTGGGCCCTGG - Intronic
1056187832 9:84153907-84153929 CTGTTTGCAAAGTTGGTCCTTGG + Intergenic
1057822185 9:98341245-98341267 TTGTGGGCACAGATGTGTCTGGG - Intronic
1059445412 9:114334895-114334917 CTGTGGGCACAGCTGTGGTTTGG - Exonic
1060728910 9:126024870-126024892 TGGTGGGCAGAGCTGGGCCTGGG + Intergenic
1061087451 9:128407481-128407503 CTGTGAACAGAGGTGGGCCTGGG - Intergenic
1061451997 9:130672616-130672638 CTCAGGGCTCAGATGGGCCTAGG - Intronic
1061878628 9:133557354-133557376 ATGTGGACAGAGTGGGGCCTCGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062076871 9:134594443-134594465 CTGGGGGCAGAGTGGGGCCCTGG - Intergenic
1062482352 9:136758365-136758387 CTGTGGGCACTGATGGGCAACGG + Intronic
1203474886 Un_GL000220v1:142372-142394 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1186180648 X:6969579-6969601 CTGTGGGCCCAGATGTGCTTAGG - Intergenic
1187049983 X:15686305-15686327 CTGTGGGGAGAGGTGGTCCTTGG - Intergenic
1191134111 X:57045169-57045191 CAGTGGGTACAGTGGGTCCTCGG - Intergenic
1192183680 X:68931544-68931566 CTGTGGACCCAGCTTGGCCTAGG - Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1198676510 X:139136947-139136969 CTGTTGACATGGTTGGGCCTTGG - Intronic
1201911282 Y:19135776-19135798 TTGTAGGCAGAGCTGGGCCTTGG - Intergenic
1201979983 Y:19896270-19896292 CTGTGAACACATTTGGTCCTGGG - Intergenic