ID: 953388341

View in Genome Browser
Species Human (GRCh38)
Location 3:42519918-42519940
Sequence AGCTCTGGGAGAGCAGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953388341_953388344 -9 Left 953388341 3:42519918-42519940 CCCGGGGCTGCTCTCCCAGAGCT 0: 1
1: 1
2: 5
3: 41
4: 447
Right 953388344 3:42519932-42519954 CCCAGAGCTAGCATTCTCATTGG 0: 1
1: 0
2: 0
3: 20
4: 147
953388341_953388346 8 Left 953388341 3:42519918-42519940 CCCGGGGCTGCTCTCCCAGAGCT 0: 1
1: 1
2: 5
3: 41
4: 447
Right 953388346 3:42519949-42519971 CATTGGAGAGACATTTAGTAAGG 0: 1
1: 0
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953388341 Original CRISPR AGCTCTGGGAGAGCAGCCCC GGG (reversed) Intronic
900009821 1:96038-96060 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
900025933 1:272622-272644 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
900035719 1:406479-406501 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
900057341 1:642229-642251 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
900110946 1:1005359-1005381 AGCTGAGGGACAGCAGCCCCAGG - Intergenic
900403059 1:2480540-2480562 AGAGCTGGCAGAGCAGCCCCCGG - Intronic
900460613 1:2800749-2800771 GGCGCTGGGGGAGCTGCCCCTGG - Intronic
900668044 1:3828986-3829008 AGCTCTGGGCCCACAGCCCCTGG + Intronic
900964550 1:5948646-5948668 GGCTCTGGGGAAGCAGCCTCTGG - Intronic
900981229 1:6047439-6047461 GACTCTGGGAGGGCTGCCCCAGG - Intronic
901685597 1:10941851-10941873 AGCTTTGAGAAAGCAGCCACGGG + Intergenic
902369666 1:15997963-15997985 AGCTCAGGAAGAGAAGTCCCAGG - Intergenic
902567420 1:17321306-17321328 AGCACAGGGAGAGCAGCACGGGG + Intronic
902728289 1:18351660-18351682 AGCTTTGTGAGAGAAGCCTCTGG - Intronic
902862648 1:19257243-19257265 GGCTCAGGGAGAGCAGGGCCTGG + Intronic
903052813 1:20614167-20614189 AGCTCTGTGAGGGCAGGGCCTGG - Intronic
903134933 1:21303086-21303108 AGTTCTGGGAAAGCAGCCAGTGG - Intronic
904000161 1:27334318-27334340 ATCCTTGGGAGAGCAGCCTCTGG - Intronic
904030082 1:27528168-27528190 AGCGCTAGGCGGGCAGCCCCGGG + Intergenic
905225181 1:36474029-36474051 GGCTCTGGAAGGGCAGCCCTGGG + Intronic
905280351 1:36845311-36845333 TGCTCTGGGAGAACAGCCATAGG + Intronic
905463781 1:38137851-38137873 AGCCCCGGGAGAAGAGCCCCAGG - Intergenic
905480970 1:38261743-38261765 AGTTCCAGCAGAGCAGCCCCTGG - Intergenic
906154623 1:43606693-43606715 GGGTCTGGGAGACCAGGCCCAGG + Intronic
906223753 1:44104056-44104078 AGATCTGGGACTGCAGCTCCCGG + Intergenic
906544785 1:46613333-46613355 AGCCCCTGGACAGCAGCCCCAGG - Exonic
906637775 1:47421019-47421041 GGTTCTGGGAGAGATGCCCCAGG - Intergenic
906662549 1:47593287-47593309 TGCTCTGAGAGGTCAGCCCCGGG - Intergenic
906670324 1:47649528-47649550 ATCTCTGGGAAAGAATCCCCTGG + Intergenic
906933964 1:50195706-50195728 AGAGCTGGGAGAGCAGGGCCTGG - Exonic
907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG + Intergenic
908401141 1:63774077-63774099 AGCCCCGGGACGGCAGCCCCTGG + Exonic
910513858 1:88036718-88036740 CCCTCTGGGAGTGCTGCCCCAGG - Intergenic
912977881 1:114346311-114346333 AGCTCTGGGAAAGGAGGGCCGGG + Intergenic
915143579 1:153781287-153781309 AGGTGTGGGAGAGCAGCTGCAGG - Intergenic
915296759 1:154926794-154926816 AGCTCTGAGAGGGCAGGCACAGG - Intronic
915619758 1:157073949-157073971 AGATCTGGGACTGCAGCTCCCGG - Intergenic
916043575 1:160981791-160981813 ATCTCTGGGAGAGTAGATCCTGG - Intergenic
916608160 1:166363552-166363574 AGCTCTGGGAGAGGTGGCCAGGG - Intergenic
917727459 1:177841144-177841166 ACCTCTGGAAGACCAGGCCCAGG + Intergenic
917817515 1:178725548-178725570 CGCGCAGGGCGAGCAGCCCCGGG - Intronic
918145656 1:181753601-181753623 AGGCTTGGGAGAGCAGGCCCAGG - Intronic
918495453 1:185130834-185130856 AGCTCTGGGAGAGCCACACTGGG - Intronic
919549329 1:198965285-198965307 AGCTGTGAGAGAGAAGCACCAGG - Intergenic
920047274 1:203141388-203141410 ACCTCTGGGAGAGCAGGGGCTGG + Intronic
920380150 1:205530447-205530469 AGCCCCAGCAGAGCAGCCCCGGG + Intronic
921053043 1:211524722-211524744 GCCGCTGGGAGAGCAGCCCATGG - Intergenic
922258253 1:223912045-223912067 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
922614471 1:226953538-226953560 AGCTCTGAGAGCCCAGCCCTGGG + Intronic
924339449 1:243014809-243014831 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
1062861656 10:815156-815178 AGCCTTGGGAGAGCAGCACAAGG + Intronic
1063472201 10:6297194-6297216 AGTGCTGGAAGAGCAGCCCAGGG + Intergenic
1063482319 10:6386554-6386576 AGCCCTGTGAGACCAGCACCAGG - Intergenic
1064246022 10:13668313-13668335 AGCTCAGGAACAGCTGCCCCAGG - Intronic
1064359758 10:14653508-14653530 AGCTCTGGGAGAAAAGCCCATGG + Intronic
1065435333 10:25699595-25699617 AACACTGGCAGAGGAGCCCCTGG + Intergenic
1065713244 10:28537366-28537388 AGCTCTTGGAGAGCAGGTACTGG + Intronic
1066598399 10:37077467-37077489 AGCTCCAGGAGAGCAGCCATGGG + Intergenic
1067197522 10:44135201-44135223 AGGTCTGGGTGAGCAGACCTTGG - Intergenic
1067453400 10:46396575-46396597 AGCTCTTATAGAGCAGCCCCAGG - Intergenic
1067583835 10:47463191-47463213 AGCTCTTATAGAGCAGCCCCAGG + Intronic
1067633838 10:47988539-47988561 AGCTCTTATAGAGCAGCCCCAGG + Intergenic
1067806890 10:49398523-49398545 GGCTCCGGGAGAGGAGCGCCGGG - Intergenic
1069564454 10:69453940-69453962 AACTCTGCCAGAGCAGCTCCAGG + Intronic
1070153639 10:73820120-73820142 AGAGCTGGGAGAGCATGCCCTGG - Intronic
1070849360 10:79551162-79551184 AGCTCTGGCAGAGGAGGCCTGGG + Intergenic
1072753191 10:97999166-97999188 AGTCCTGGGTCAGCAGCCCCAGG - Intronic
1073137603 10:101228569-101228591 AGGTCTGCGAGAGCAGCGCGCGG + Exonic
1073283860 10:102375355-102375377 TGCGCAGGGAGAGCAGCACCTGG - Exonic
1073328235 10:102654897-102654919 GGCTCTGGGCCAGCATCCCCTGG - Intronic
1076698107 10:132256800-132256822 GCCTCTGGGCGGGCAGCCCCAGG - Intronic
1077120325 11:904500-904522 ACCTCTGAGTGAGCAGCCTCTGG - Intronic
1077201368 11:1309208-1309230 AGCTTTGGGGAGGCAGCCCCGGG - Intronic
1077297364 11:1832464-1832486 ACAACGGGGAGAGCAGCCCCGGG + Intronic
1077366450 11:2163208-2163230 ACCTTGGAGAGAGCAGCCCCAGG - Intergenic
1077535052 11:3120079-3120101 AGAGCTGGCAGGGCAGCCCCGGG + Intronic
1077632580 11:3821094-3821116 AGCTCTGGGAGAGAAGATGCTGG - Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1083418076 11:62538162-62538184 AGCTCTGGGAGCCCTGCCACAGG + Intronic
1083547944 11:63562975-63562997 GGCTCAGGGAGAGCAGCCCTTGG - Intronic
1083658978 11:64243372-64243394 AGCTGTGGGAGGCAAGCCCCAGG + Intronic
1083727056 11:64634151-64634173 AGCTCTGGGTGAGGGGCCCCTGG - Intronic
1083766259 11:64843001-64843023 AGCTGGGGAGGAGCAGCCCCGGG + Intronic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1084064760 11:66697450-66697472 AGAGGTGGGAGAGAAGCCCCGGG - Intronic
1084083652 11:66844782-66844804 AGTTGTGGGAGAGGAGCCCTTGG + Intronic
1084675355 11:70630852-70630874 CCCTTTGTGAGAGCAGCCCCAGG + Intronic
1084858095 11:72001545-72001567 AGCTCTGGGTGAGGAGCCCAAGG + Exonic
1085033726 11:73287914-73287936 AGCTGTGACAGGGCAGCCCCCGG - Intronic
1085249785 11:75135382-75135404 GGCTCTGGGAGGGCAGCGTCTGG - Intronic
1085451405 11:76636234-76636256 AGCTCTGGCAGTGCAGCCAGGGG + Intergenic
1085891495 11:80585056-80585078 AGCTCCAGGAGAGCAGCCATGGG - Intergenic
1086514856 11:87599994-87600016 AACTCTGGTATAGCAGGCCCTGG - Intergenic
1088513320 11:110599846-110599868 AGCTCTGAGAGAGGAGGCCCTGG - Intronic
1088619961 11:111671669-111671691 AGATCTGGGACAGCAGCTCCTGG + Intronic
1089113311 11:116073919-116073941 AACTCTTGGGGAGCAGCCACGGG + Intergenic
1089541349 11:119190772-119190794 AGCTCTCGGAGAGCGGGACCAGG - Exonic
1089602140 11:119622836-119622858 AGCTGGGGGAGAGCAAACCCAGG - Intergenic
1089743648 11:120602079-120602101 AGCCCGGGGAAGGCAGCCCCGGG - Intronic
1089793029 11:120958098-120958120 AGCCCTGGGAGAGGAGCATCGGG + Intronic
1090651491 11:128810490-128810512 CGCTGTCGGAGAGCAGCTCCAGG - Exonic
1091097094 11:132834394-132834416 TGCTTTGTGACAGCAGCCCCAGG - Intronic
1091298266 11:134488593-134488615 AACTCTGAGAGAGAAGCCACTGG - Intergenic
1091568007 12:1662267-1662289 AGCTCAGGCAGAGCAGGCCGCGG - Intergenic
1091841550 12:3624963-3624985 CACTCTGGGAGAGAAGGCCCTGG + Intronic
1096626664 12:52900038-52900060 AGATCTGGGACTGCAGCTCCCGG + Exonic
1098079261 12:66766505-66766527 AGCTCTTGGGGAGCAGACACTGG + Intronic
1098264654 12:68706330-68706352 AGATCTGGGACTGCAGCTCCCGG - Intronic
1098521632 12:71440139-71440161 AGACCTGGGAGAGCTGCCCCCGG - Exonic
1101489844 12:105200479-105200501 GGCTCTGGGACATTAGCCCCTGG + Intronic
1102496038 12:113320316-113320338 GGCTCTGGGTGAGCAGCTCTGGG - Exonic
1103414637 12:120736034-120736056 ATCTCTGGGAGAGCAGGGACAGG - Intronic
1103539059 12:121653315-121653337 AGCTCTGGAAGAGCGACCCCTGG - Intronic
1103547553 12:121712848-121712870 AGCGCTGCGGGAGCAGCCGCCGG + Exonic
1103762748 12:123263538-123263560 AGCTACCGGAGAGCAGCCCTGGG + Intronic
1103845853 12:123901589-123901611 TGCTTTGTTAGAGCAGCCCCGGG - Intronic
1104016393 12:124965087-124965109 AGCTCTGGTGGAGCAGCCTGGGG - Intronic
1104159403 12:126163960-126163982 AGGCCTGGAAGAGCAGCTCCAGG - Intergenic
1104789209 12:131471417-131471439 AGCTCTGGGAGAGCAGGAGCAGG - Intergenic
1104844142 12:131838463-131838485 ATCTTTGGGGGACCAGCCCCAGG - Intronic
1104860953 12:131923272-131923294 AGCCCTGGGAGCAGAGCCCCAGG + Intergenic
1104871618 12:132002638-132002660 TGCTCTCGGACACCAGCCCCAGG - Intronic
1107027978 13:35823067-35823089 AGCTCTGGGGGAGATGCCACTGG - Intronic
1107184990 13:37507105-37507127 AGCTCTGAGACAGCAGCACCAGG + Intergenic
1108347548 13:49561108-49561130 AACTCTGGGAGACCTGCCCTTGG - Intronic
1108409305 13:50130808-50130830 AGCCCCGGGAGGGCAGCTCCGGG + Intronic
1109808125 13:67470873-67470895 GGCACTGGGAGGGCAGACCCAGG + Intergenic
1110696328 13:78495464-78495486 AGCTGTGGTTGACCAGCCCCTGG + Intergenic
1111165608 13:84454256-84454278 AGCTGTGAGAGAGAAGCACCAGG - Intergenic
1112443795 13:99445201-99445223 AGATCTGGGAGAGCTGGCCTTGG - Intergenic
1112734364 13:102400513-102400535 AGCTGTGGGCGAGCAACCCAGGG - Intronic
1113269792 13:108661186-108661208 AGCTCTGAGACAGAAGCACCAGG - Intronic
1113371745 13:109731462-109731484 AGCTCCGGGAGAGCCGGCTCAGG - Intergenic
1113946717 13:114048594-114048616 TGCTCTGTGAGGGCAGCGCCCGG + Intronic
1114449502 14:22815712-22815734 TGCTCTGGGACAGCTTCCCCAGG - Exonic
1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG + Intronic
1117543855 14:56774696-56774718 AGCTCAGTGAGGGCGGCCCCAGG - Intergenic
1117844173 14:59893853-59893875 AGCCCTGGGATATCAGCCCAGGG + Intergenic
1118003938 14:61548417-61548439 AGAGCTTGGAGAGGAGCCCCTGG - Intronic
1118055817 14:62078546-62078568 TGCTTTGGGAGTGCAACCCCAGG + Intronic
1118063074 14:62161896-62161918 AGCTGTGGCAAAGCAGTCCCAGG - Intergenic
1118758757 14:68864756-68864778 AGTTCTGGGAGGAAAGCCCCAGG + Intergenic
1119113665 14:71998396-71998418 ATCTCTGGAAGGGCAGCCCCAGG + Intronic
1119427396 14:74544598-74544620 AGCTCTGTGATGCCAGCCCCTGG - Intronic
1119566209 14:75631336-75631358 AACTCTGGGAGTGAGGCCCCCGG - Intronic
1119632575 14:76246366-76246388 AGCTCAGTGATTGCAGCCCCGGG + Intronic
1120116197 14:80620160-80620182 TGCACTGGGAGAGCAGACCAGGG + Intronic
1120187145 14:81405632-81405654 AGCTCTAGGCGAGCAGCACTTGG - Intronic
1121327195 14:93028052-93028074 GGCTGTGGGAGAGCAGCCTCCGG - Intronic
1121619736 14:95337766-95337788 AGCTCTGTGCTAGCAGCCCTGGG - Intergenic
1122119853 14:99546416-99546438 AGCACTGGGAGAGCGGCTCAGGG + Intronic
1122144920 14:99683610-99683632 GTCTCTGGGAGAACAGCCTCCGG + Intergenic
1122319775 14:100847337-100847359 AGCAGTGGGAGTGCAGCGCCAGG + Intergenic
1122805323 14:104253505-104253527 AGCTTTGGGATGCCAGCCCCAGG - Intergenic
1122893831 14:104745521-104745543 AGCCCTGGGCGAGCTGCTCCTGG + Intronic
1123141977 14:106088631-106088653 AGCTCTGGGAGAGGAGCCCCAGG - Intergenic
1123467729 15:20528925-20528947 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1123650384 15:22472117-22472139 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1123728042 15:23124134-23124156 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1123740792 15:23280959-23280981 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1123746206 15:23321599-23321621 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1124278473 15:28344916-28344938 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1124304227 15:28566692-28566714 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1128415174 15:67438137-67438159 AGCTGTGAGAGAGAAGCACCAGG + Intronic
1129181691 15:73881914-73881936 AGCTCAGGGAGAGAAGGCACTGG - Intronic
1129184774 15:73899413-73899435 AGCTCTGGGAGTGCAGCCTGGGG - Intergenic
1129612832 15:77074057-77074079 TGCTCTGGGTGAGCTGGCCCAGG - Intronic
1129697142 15:77747147-77747169 AGCTCTGGAGGAGCAGTCCTGGG - Intronic
1129882492 15:79016558-79016580 CCCTCTGGGCAAGCAGCCCCAGG + Intronic
1130260642 15:82351774-82351796 AGCAATGGCACAGCAGCCCCGGG - Intergenic
1130594263 15:85238053-85238075 AGCAATGGCACAGCAGCCCCGGG + Intergenic
1130705896 15:86232664-86232686 AGCTCTGAAAAAGCAGCTCCGGG - Intronic
1131351518 15:91705076-91705098 ATCTCTGGGAGAACATGCCCAGG + Intergenic
1131827910 15:96334631-96334653 AGCTCTGGGCTAGGAGCCCGTGG - Intronic
1131985006 15:98034133-98034155 AGTTCTGGGAAAGAAGCCTCGGG - Intergenic
1132629801 16:911671-911693 AGCACTGGGGGAGCAGCACTGGG + Intronic
1132629805 16:911685-911707 AGCACTGGGGGAGCAGCACTGGG + Intronic
1132664174 16:1074084-1074106 AGCTCTGTGAGTGCAGCCAATGG - Intergenic
1132767634 16:1542451-1542473 AGCTGGTGGGGAGCAGCCCCTGG + Intronic
1133796130 16:9047913-9047935 AGCTCTGGGAGAGCAAGAGCCGG + Intergenic
1135159561 16:20081681-20081703 AGCTCTAGCAGAGCAGACCAAGG - Intergenic
1135487054 16:22874822-22874844 AGCTCTGGGAGAGCCTCACAGGG - Intronic
1135904468 16:26498638-26498660 AGCTCTGGCAAAGCAGCACATGG + Intergenic
1136397699 16:30002028-30002050 AGCTCTGTGAGGGCAGGCACTGG - Intronic
1136580984 16:31150519-31150541 AGGTCTGGGACAGGAGCCCTAGG + Intergenic
1136876253 16:33859416-33859438 AGCTCTGGGAGTGGAGCCCCTGG - Intergenic
1139073916 16:63419595-63419617 AGCTCTGGGGGAGTAAGCCCTGG - Intergenic
1141814836 16:86402508-86402530 TGCTTTGATAGAGCAGCCCCAGG - Intergenic
1142324202 16:89403467-89403489 CGCTCTGGGAGGGCACCCCCAGG + Intronic
1142454508 16:90210867-90210889 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1143710150 17:8728731-8728753 GGCTCAGGAAGAGCAGACCCAGG + Intergenic
1144647769 17:16987208-16987230 GGCTCAGGGAGAGAAGGCCCAGG - Intergenic
1144726876 17:17506599-17506621 AGAGCTGGGAACGCAGCCCCAGG + Intronic
1144765510 17:17730441-17730463 AGCTCTGCCAGGGCAGCCCATGG + Intronic
1145790414 17:27623159-27623181 AGCCCTGGCAGAGCTGCCCCTGG - Exonic
1145992452 17:29087193-29087215 AGCTCTGGGTGAGGAGGCCTGGG + Intronic
1147160608 17:38567583-38567605 ACCCCTGGGAGAGCACCCTCAGG - Intronic
1147537806 17:41332351-41332373 AGCTCAGGGAGAGAAGGCCCAGG - Intergenic
1147538001 17:41333439-41333461 AGCTCAGGGACAGAAGTCCCAGG + Intergenic
1147860314 17:43517191-43517213 AGAGCTGGGAGAACAGGCCCAGG + Exonic
1150227106 17:63530218-63530240 AGCTCTGGGACAACAGGCGCTGG - Exonic
1151218015 17:72591229-72591251 ACCTCTGGGAAAGCATCCTCAGG + Intergenic
1151767098 17:76138275-76138297 AGCTCTGGGACACCAGCCACAGG + Intronic
1151965695 17:77430130-77430152 GGGGCTGGGAGGGCAGCCCCAGG - Intronic
1152289163 17:79429090-79429112 ACCTCTGCCAAAGCAGCCCCAGG + Intronic
1152504416 17:80738146-80738168 GGTGCTGGGAGGGCAGCCCCAGG + Intronic
1152531229 17:80920428-80920450 AGTTTTGTGACAGCAGCCCCAGG + Intronic
1203170102 17_GL000205v2_random:140648-140670 GGCTGTGGGAGAGTAGCCCGGGG + Intergenic
1153619854 18:6967544-6967566 CTCTCTGGGAGGGCTGCCCCAGG + Intronic
1154355694 18:13621933-13621955 AGGCTTGGGACAGCAGCCCCTGG - Intronic
1155894051 18:31301237-31301259 AGCACTGGGAAAGCAGCACTCGG + Intergenic
1156294183 18:35774813-35774835 AGCTCTGAAAGAGGAGTCCCGGG - Intergenic
1156493035 18:37507661-37507683 AGCTGTGAGAGAGCAGACCTGGG + Intronic
1156537110 18:37874811-37874833 GGCTCTGGGGGAGCAGACTCGGG + Intergenic
1157562612 18:48659489-48659511 AGCCCTGGGGGTGCAGCTCCAGG - Intronic
1157613951 18:48976024-48976046 AGCTCTGGGAGCGCGGCGCCGGG - Intergenic
1157977508 18:52342402-52342424 AGCTCCGGGAGAGAAGAGCCAGG - Intronic
1158474660 18:57769283-57769305 AGATCTGGCAGGGCAGGCCCAGG - Intronic
1158477694 18:57794842-57794864 AGCTCAGTGAGAGCAGCTGCAGG + Intronic
1159984804 18:74829435-74829457 AGATCTTGGAGAGCAACTCCTGG + Intronic
1160922700 19:1528397-1528419 GGCACTGGGTGAGCAGCCGCTGG - Exonic
1161087339 19:2341155-2341177 AGCCCTGTCAGAGCAGCCCGGGG - Exonic
1161456947 19:4374385-4374407 GGCTCCGTGAGGGCAGCCCCAGG + Intronic
1161588366 19:5117628-5117650 GGCTCTGGGAAGGCAGCCTCAGG - Intronic
1162267149 19:9584762-9584784 AGCTCTGCAGGAGCATCCCCTGG - Intergenic
1162271775 19:9621566-9621588 AGCTTTGGAGGAGCATCCCCCGG - Exonic
1162567879 19:11454134-11454156 GGGTCTGGGAGGGCACCCCCTGG + Exonic
1163062074 19:14768174-14768196 AGCTCTGAGAGCCCAGCTCCAGG + Intronic
1163618910 19:18346211-18346233 ACCTCTGCGAGAACCGCCCCTGG + Intronic
1164586297 19:29478203-29478225 ACTTCTGGGTGAGCAGCCCCAGG - Intergenic
1164604725 19:29589496-29589518 AGCTGTGGGAGGACTGCCCCAGG + Intergenic
1165053927 19:33161559-33161581 AGCTCAGATAGACCAGCCCCAGG - Intronic
1165274193 19:34734035-34734057 GGCTCTGGGACGACAGCCCCAGG + Intergenic
1165545031 19:36528273-36528295 ACCTCTGGGAGCGCTGCCCGCGG - Exonic
1165792408 19:38500169-38500191 AGCTCTGTGAGACCAGGCCCTGG - Intronic
1165907038 19:39200449-39200471 ACTTCTGGGAGAGGACCCCCTGG + Exonic
1166659597 19:44637696-44637718 AGCCCTAGGAGGGCAGGCCCAGG - Intergenic
1167287623 19:48607372-48607394 GGATCTGGGAGAACAGTCCCAGG - Exonic
925850355 2:8075623-8075645 AGCACTGGCAGAGAAGCCCCTGG + Intergenic
926077245 2:9951466-9951488 AGCCCCGGGAGCGCAGTCCCGGG + Intergenic
926151245 2:10426814-10426836 AGTTCTGAGCGAGCGGCCCCTGG + Exonic
928079157 2:28293524-28293546 AGCTCTGGGACTGCAACCCGCGG + Intronic
928087808 2:28356675-28356697 AGCTCTGGGAGCCCAGGCCAAGG + Intergenic
928983158 2:37156728-37156750 AGCACTGGGAGAGCAGGCCCAGG - Intronic
929904681 2:46035512-46035534 AAGTCTGGGAGGGCACCCCCTGG - Intronic
931996970 2:67848009-67848031 AGATCTGAGACAGCAGACCCAGG - Intergenic
932436558 2:71705380-71705402 TGCTCTGGGCCAGCAGACCCCGG - Intergenic
932940745 2:76161931-76161953 AGCTCTCAGAGAGCAATCCCTGG - Intergenic
933642802 2:84782331-84782353 AGCCCTGGGAGAGAACCTCCAGG + Intronic
933726310 2:85429591-85429613 AGCTCAGTGGGAGCAGGCCCCGG + Intronic
933760473 2:85668630-85668652 AGCCCTGGAAGGGCAGACCCAGG + Intronic
934504326 2:94879384-94879406 AGTTCTGGCCCAGCAGCCCCAGG - Intergenic
934527980 2:95063724-95063746 GGCTCTGGGAGAGACCCCCCAGG - Intergenic
934746675 2:96763899-96763921 GGCTTTGGGAGTGCAGACCCAGG + Intronic
935180159 2:100682051-100682073 AGCTCTGCGGGAGCAGAGCCAGG - Intergenic
936278487 2:111119783-111119805 CGCGTTGGGAGAGCAGACCCGGG + Intronic
936351902 2:111719358-111719380 AGCTCTGGGATTACAGGCCCAGG + Intergenic
937125598 2:119473373-119473395 GGCCCTGGGAGAGGAGGCCCTGG - Intronic
937281022 2:120717196-120717218 AGCTCTGGGATGGGAGGCCCTGG + Intergenic
937436461 2:121885753-121885775 AGCTGTGGGGGAGAAGACCCTGG + Intergenic
938055781 2:128213644-128213666 AAGTCAAGGAGAGCAGCCCCAGG + Intergenic
938548143 2:132353334-132353356 AGCTCTGGCAGAGGAGGACCCGG + Intergenic
940618527 2:156082535-156082557 AGCTGTGAGAGAGAAGCACCAGG - Intergenic
943064481 2:183071770-183071792 AGATCTGGGACTGCAGCTCCGGG + Intergenic
944431148 2:199634794-199634816 AGCTCTGGCAGCACAGGCCCAGG - Intergenic
944904229 2:204246290-204246312 GGCCCTTGGAGAGAAGCCCCTGG + Intergenic
946181955 2:217954193-217954215 AGCCCTAGGAGCCCAGCCCCTGG - Intronic
947873983 2:233456274-233456296 AGCTGTGGTAGAGCAGTGCCCGG + Intronic
947947915 2:234122237-234122259 AGCACTGTGAGCCCAGCCCCTGG + Intergenic
948053017 2:234992476-234992498 AGCTCTGGGTCTGGAGCCCCTGG + Intronic
948208717 2:236177290-236177312 AGCCGTGGGAGGGCAGCCTCTGG + Intergenic
948462042 2:238134457-238134479 GCCTCTGGGGGAGCTGCCCCAGG + Intergenic
948905197 2:240976555-240976577 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905219 2:240976645-240976667 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905319 2:240977050-240977072 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905419 2:240977455-240977477 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905430 2:240977500-240977522 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905452 2:240977590-240977612 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905463 2:240977635-240977657 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905474 2:240977680-240977702 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905530 2:240977905-240977927 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905552 2:240977995-240978017 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905709 2:240978625-240978647 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905731 2:240978715-240978737 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905752 2:240978805-240978827 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905774 2:240978895-240978917 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905873 2:240979300-240979322 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905884 2:240979345-240979367 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905906 2:240979435-240979457 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948905940 2:240979570-240979592 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906052 2:240980020-240980042 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906095 2:240980200-240980222 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906185 2:240980560-240980582 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906207 2:240980650-240980672 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906228 2:240980740-240980762 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906250 2:240980830-240980852 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
948906272 2:240980920-240980942 AGCTCTGGGGTAGGAGCCTCAGG + Intronic
949085967 2:242155521-242155543 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1169212983 20:3778010-3778032 AACTCTAGGAGCGCAGGCCCGGG - Exonic
1169557428 20:6766445-6766467 AGCTCTGGGAAAGCAGAACTTGG + Intergenic
1171108371 20:22457626-22457648 AGCTCTTACAGGGCAGCCCCTGG - Intergenic
1171403468 20:24893793-24893815 AGCTCTGGGTGTGCTGCCGCTGG - Intergenic
1171424149 20:25039089-25039111 TGCTCTGTGGGAGCAGCCCTGGG - Intronic
1171877014 20:30586106-30586128 AGCTCTGGCAGAGGAGGACCCGG + Intergenic
1172124390 20:32616629-32616651 AGTTCAGGGAGGGCAGGCCCTGG + Intergenic
1173594056 20:44247555-44247577 AGCTTGGGGAGGGGAGCCCCAGG + Intronic
1175511204 20:59527515-59527537 AGGTCTGGGAGCACAGACCCAGG - Intergenic
1175540491 20:59744798-59744820 AGCTCTGGGTGGGCAGGGCCTGG - Intronic
1176054682 20:63138147-63138169 AGCTCTTGGAGAGGTGGCCCTGG + Intergenic
1176081020 20:63273040-63273062 AGCTCTGGGGCAGCAGCCTCAGG - Intronic
1176190922 20:63809227-63809249 AGCCCTGGGGGCGCAGCCCTGGG + Intronic
1178820492 21:35970834-35970856 ATCACTGTGAGAGCAGCCCCTGG - Intronic
1179075185 21:38114040-38114062 AACACAGGGTGAGCAGCCCCAGG - Intronic
1179642256 21:42755500-42755522 AGCTCTGAGAGTGCAGGACCGGG + Intronic
1179943256 21:44653435-44653457 ATCTCTGACAGAGCTGCCCCCGG + Intronic
1179975401 21:44862718-44862740 AGCCCTGGGAAAGAAGGCCCAGG - Intronic
1180001525 21:44997487-44997509 AGCTCTGGGAGCTGGGCCCCGGG + Intergenic
1180101760 21:45590809-45590831 AGCCATGGGAGAGGACCCCCGGG - Intergenic
1180233589 21:46443041-46443063 CGCTCTGGGACAAGAGCCCCTGG - Intronic
1180732720 22:17994133-17994155 AGGGGTGGGAGAGCAGCACCTGG - Intronic
1180766742 22:18349678-18349700 AGCTCTGGGAAAGCAGAGCTGGG - Intergenic
1180779572 22:18512700-18512722 AGCTCTGGGAAAGCAGAGCTGGG + Intergenic
1180812287 22:18770021-18770043 AGCTCTGGGAAAGCAGAGCTGGG + Intergenic
1181064436 22:20298989-20299011 AGCTCAGGGCGGGTAGCCCCGGG + Intergenic
1181198446 22:21204268-21204290 AGCTCTGGGAAAGCAGAGCTGGG + Intergenic
1181317063 22:21977875-21977897 AGTTCTGGGAGGGCAGGACCTGG - Intronic
1181444336 22:22957223-22957245 AGGTCTGGAGGATCAGCCCCAGG - Intergenic
1181531819 22:23521532-23521554 GGCTCCGGGAGGGCAGCCCCGGG + Intergenic
1181648241 22:24245358-24245380 AGCTCTGGGAAAGCAGAGCTGGG + Intergenic
1182309295 22:29393338-29393360 TGCTGTGGGAGAGCAGGTCCAGG - Intronic
1182827477 22:33278198-33278220 GACTCTAGGAGAGCAGTCCCTGG + Intronic
1183258630 22:36779564-36779586 AGCTCTGGGAGGGCAGCAGATGG + Intergenic
1183335667 22:37244479-37244501 AGTTCTTGGAGAACAGCCTCTGG - Intergenic
1183442937 22:37833547-37833569 AGCCCTGGGAGTGCAGGCCTAGG + Intronic
1183629660 22:39025493-39025515 AGGCCTGGGAGGGCAGGCCCAGG + Intronic
1183654237 22:39175753-39175775 AGATCTGCAAGAACAGCCCCGGG + Intergenic
1184697632 22:46149075-46149097 AGCTCTGCGTGGGCAGCCCAGGG + Intergenic
1185014103 22:48333482-48333504 CGCCCTTGCAGAGCAGCCCCAGG - Intergenic
1185037397 22:48486655-48486677 GGCTATGGGAGAGCAGTGCCTGG - Intergenic
1185048470 22:48541066-48541088 AGGGCTGGGAGTGAAGCCCCAGG + Intronic
1185394932 22:50582092-50582114 AGCTCTGGGAATACAGGCCCAGG + Intronic
1203228361 22_KI270731v1_random:90569-90591 AGCTCTGGGAAAGCAGAGCTGGG - Intergenic
949386333 3:3506372-3506394 AGGGCTGGGAGACCAGCTCCTGG - Intergenic
950518089 3:13480324-13480346 AGCTTTGGGAGGGCCGGCCCCGG + Exonic
950607522 3:14096094-14096116 CTCCCTGTGAGAGCAGCCCCAGG - Intergenic
950651434 3:14409743-14409765 GTCTGAGGGAGAGCAGCCCCAGG + Intronic
952684383 3:36132046-36132068 AGAGCTGGGAGAGGAGCCCTGGG - Intergenic
952867200 3:37862038-37862060 CGCTCTGGGAGAGGCGGCCCGGG - Intronic
953006957 3:38987743-38987765 CTCCCTGAGAGAGCAGCCCCGGG - Intergenic
953388341 3:42519918-42519940 AGCTCTGGGAGAGCAGCCCCGGG - Intronic
953407746 3:42667838-42667860 AGCTCTGGGACAGCAGGGACCGG + Intergenic
953875496 3:46664349-46664371 AGGTCTGGGGTAGCTGCCCCTGG - Intergenic
954792316 3:53142483-53142505 AGCTCTTGGCCAGCACCCCCAGG - Intergenic
955324769 3:58001480-58001502 AGCTCTGTGAGAGGGGTCCCAGG - Intergenic
955769256 3:62372569-62372591 AGCTCTGGAAAAGCAGCCTCCGG - Exonic
955839533 3:63097092-63097114 AGATCTGGGACTGCAGCTCCCGG + Intergenic
956750973 3:72343742-72343764 TGCTCTGGGAGAGCAGGCTTAGG + Intergenic
958088142 3:88839619-88839641 AGCTGTGGGACAGAAGCACCAGG - Intergenic
959010807 3:101073741-101073763 ACCTCTATGAGAGCAGACCCTGG + Intergenic
959883745 3:111475168-111475190 AGTTCTGGGAAAGCAGGCTCAGG - Intronic
960592406 3:119378683-119378705 AGCCAAGGGAGAGAAGCCCCGGG - Intronic
960593957 3:119391424-119391446 AGCTCTGGGTGAGCAGCAGTTGG + Intronic
962712861 3:138102199-138102221 AGATCTGGGACTGCAGCTCCCGG + Intronic
964497889 3:157313680-157313702 AGCTCTGTGGGAGAAGACCCAGG - Exonic
964802191 3:160568520-160568542 AGATCTGGGACTGCAGCTCCCGG - Intergenic
964862804 3:161221159-161221181 AGCTCGCGGAGAGAAGTCCCAGG - Intronic
965605718 3:170496127-170496149 AGATCTGGGACTGCAGCTCCTGG - Intronic
965629541 3:170717596-170717618 AGCTCTTGGCAAGCAGCCCGGGG - Intronic
966917246 3:184591918-184591940 AGCTCTGCGCCAGGAGCCCCAGG + Intronic
967694438 3:192514951-192514973 GGCTCTCGGAGGGCTGCCCCCGG - Intronic
968621379 4:1604837-1604859 AGCACTGGGGGAGCCGCCGCAGG - Intergenic
969296397 4:6272570-6272592 AGCTCTAAGGGAGCAGGCCCAGG - Intronic
969407660 4:7004825-7004847 AGCTCTGGAAGAAAAGCCTCTGG - Exonic
969849422 4:9944551-9944573 ACCTCAGGGTGGGCAGCCCCCGG + Intronic
970194836 4:13543377-13543399 AGGTCTGGGAGAGCAGCCCTAGG - Intronic
971298899 4:25425709-25425731 AGCTCTGTGAGTGCAGCCATGGG - Intergenic
976129786 4:81871709-81871731 AGATCTGGGATGGCAGCTCCAGG - Intronic
977022775 4:91776744-91776766 AACACTGGGTGAGCAACCCCAGG + Intergenic
977241625 4:94577398-94577420 AGCTCTAGAAGAACAGCTCCTGG + Intronic
977928725 4:102729455-102729477 AGATCTGGGACTGCAGCTCCTGG + Intronic
981057113 4:140374104-140374126 GGCTCTCGCAGAGCAGCCACGGG - Intronic
984266498 4:177503851-177503873 AGCTGTGAGACAGCAGCACCAGG - Intergenic
985673630 5:1219149-1219171 ACCTGTGGGATGGCAGCCCCCGG + Intronic
988054316 5:26073686-26073708 AGCTCTGAAAGACCAGCCCAGGG - Intergenic
988614925 5:32766014-32766036 TGGTCTGGGAGAGCAGCCCCTGG + Intronic
989799708 5:45522724-45522746 AGCTGTGGTTGACCAGCCCCTGG - Intronic
990382556 5:55231644-55231666 AGCTCTGGAAGCGCAAGCCCTGG - Exonic
990900544 5:60744285-60744307 AGATCTGGGACTGCAGCTCCTGG + Intergenic
992206020 5:74430789-74430811 AGCTCTGGGAGAGGAAAGCCTGG - Intergenic
994320854 5:98392809-98392831 AGATCTGGGACTGCAGCTCCTGG + Intergenic
997741500 5:136258807-136258829 TGCCCTGGGACAGTAGCCCCTGG - Intronic
998215606 5:140236726-140236748 AGCTCTGGAAGAACAGAGCCAGG + Intronic
998229208 5:140348732-140348754 AGCTCTGTGAAAGCAGGTCCTGG - Intergenic
998372523 5:141670883-141670905 AGCTCTGGGTGAGCACCTCAGGG + Intronic
998887222 5:146706899-146706921 AGATCTGGGACTGCAGCTCCCGG + Intronic
1001922040 5:175608505-175608527 AGCTCTGGGAGAGGGGGCCTGGG - Intergenic
1001960945 5:175880173-175880195 AGCTGAGGGGGAGAAGCCCCTGG - Exonic
1002458178 5:179357889-179357911 AGTGCTGGGACAGCAGCTCCTGG + Intergenic
1002516425 5:179762334-179762356 TGCTCTGGGAGAGGAGCTCCAGG - Intronic
1002738102 5:181412385-181412407 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1003506782 6:6746322-6746344 TGGTGTGGTAGAGCAGCCCCGGG - Intergenic
1004187871 6:13436994-13437016 GGCTCTGGGAAAGCAGGGCCTGG + Intronic
1005315447 6:24599048-24599070 AGATCTGGGACTGCAGCTCCTGG - Intronic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1006374544 6:33664731-33664753 AGCTGTGGGACAGGAGCCACTGG - Intronic
1006467066 6:34202241-34202263 AGCTCTCAGAGAGGAGGCCCTGG + Intergenic
1006635434 6:35458158-35458180 AAGTCTGGGAGAGCTGCCCTAGG - Intronic
1006640228 6:35485880-35485902 AGCTCTGGGAGAGCCCTCTCAGG + Intronic
1006827390 6:36946085-36946107 ATCTCTGGCAGACCAGCACCGGG + Intergenic
1009935607 6:70231175-70231197 GGTTCTGAGAGAGCAGTCCCCGG - Intronic
1011698669 6:89935360-89935382 GGCGCTGGGAGAGGAACCCCAGG + Intronic
1016982341 6:149864439-149864461 AGGGCTGGGAGAGCAGGCCCCGG + Intergenic
1018035424 6:159877358-159877380 AGCTCTGGGGAATGAGCCCCAGG - Intergenic
1018789339 6:167134689-167134711 AGCTAGGGAAGTGCAGCCCCAGG - Intronic
1018921932 6:168181469-168181491 GGCTGTGGGGCAGCAGCCCCTGG + Intergenic
1018939916 6:168302186-168302208 ACCGCTGGGAGACCAGACCCAGG - Intronic
1019243203 6:170687944-170687966 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1019575199 7:1734446-1734468 ACCTCTGGGCTCGCAGCCCCGGG - Intronic
1019612064 7:1941635-1941657 GGCTCCGGGAGAGCAGGACCTGG - Intronic
1020109374 7:5439631-5439653 AGCTCAGGGAGGGCAGTTCCCGG - Intronic
1020264385 7:6550920-6550942 GGCCCTGGGAGAGCGGCGCCCGG + Intronic
1020702239 7:11498484-11498506 CCCTCTGGGAGTGCAGTCCCAGG - Intronic
1022110163 7:27225323-27225345 AGGTCGGGGAGAGGATCCCCAGG + Intergenic
1022441383 7:30436239-30436261 GGCTCTGGGGCAGCAGCGCCTGG - Intronic
1022591074 7:31663398-31663420 AGGACTGGGAAAGGAGCCCCTGG - Intergenic
1022652973 7:32293986-32294008 AGCCCTGGCAGAGAGGCCCCCGG - Intronic
1023131587 7:37008718-37008740 AGCTCTGGAATAGCAGATCCAGG + Intronic
1024934906 7:54702176-54702198 AGCTCTCAGAGTGCAGGCCCTGG - Intergenic
1025777283 7:64570341-64570363 GCCTCTGGGAGAGCAGCCCCCGG + Intergenic
1026468371 7:70673722-70673744 AGCTCTCTGAGAGCAGAGCCTGG + Intronic
1027270571 7:76516389-76516411 AGGTCCGGGAGCGCAGCCCAAGG - Intronic
1028135595 7:87220244-87220266 AGCGCGGGGAGAGCAGCGGCGGG - Intronic
1028712220 7:93922089-93922111 AGCTCTGGCAGCGGAGCCGCTGG - Exonic
1029139790 7:98401332-98401354 AGCTCTGGGAGAGCCGCGAGGGG - Intergenic
1032087693 7:128892453-128892475 GGCTGTGGGACAGCAGCCTCTGG + Intronic
1032511489 7:132475985-132476007 AGCCCAGCGGGAGCAGCCCCAGG + Intronic
1033220589 7:139524222-139524244 AGCGCTGGGAGCGCGGCGCCGGG + Intronic
1033350634 7:140559159-140559181 TGCCCTGAGAGAGCTGCCCCAGG - Intronic
1033457726 7:141517712-141517734 AGAGCTGGGAGTGCTGCCCCAGG - Intergenic
1034429999 7:151036470-151036492 AGCAGTGGCAGAGCAGGCCCAGG + Intronic
1034460282 7:151194205-151194227 AGCTCTGGGCAGGCAGCCCTTGG - Intronic
1035337337 7:158138353-158138375 AGCCCTGGGAGAGCGGCCCTGGG - Exonic
1035350080 7:158239360-158239382 AGCTCCGGGATACCAGCTCCGGG - Intronic
1035504919 8:120219-120241 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic
1036083168 8:5580420-5580442 AACTCTGTGACAGCAGCCCTAGG + Intergenic
1036791015 8:11720088-11720110 GGGTCTGGGAGAGGAGCCCAGGG - Intronic
1038490256 8:27965554-27965576 AGCTCCTTGAGAGAAGCCCCTGG + Intronic
1038729402 8:30113678-30113700 AAGTCTGGAAGAGCAGCCACCGG + Intronic
1039914278 8:41848471-41848493 AGCCCAGGGAGACCAGGCCCAGG + Intronic
1040369889 8:46759186-46759208 AGCTCTGGGTCAGAAGCCGCTGG - Intergenic
1041781092 8:61578915-61578937 AGATCTGGGACTGCAGCTCCCGG - Intronic
1041861089 8:62513333-62513355 ATCTCTGAGAGAGCAGCAACTGG - Intronic
1045942396 8:107754809-107754831 AGCTCTGGGAAAGCTGGCACTGG - Intergenic
1045956665 8:107915965-107915987 AGCTCTTGGAGAACAGGGCCAGG - Intronic
1049000246 8:139821346-139821368 CAGCCTGGGAGAGCAGCCCCTGG - Intronic
1049058546 8:140258031-140258053 AGCCCTGGGAGAGCGGTCACTGG - Intronic
1049395193 8:142397001-142397023 AGGTCAGGGAGTGCAGCCCCAGG - Intronic
1049395216 8:142397095-142397117 AGGTCAGGGAGTGCAGCCCCAGG - Intronic
1049395239 8:142397189-142397211 AGGTCAGGGAGTGCAGCCCCAGG - Intronic
1049395262 8:142397283-142397305 AGGTCAGGGAGTGCAGCCCCAGG - Intronic
1049542965 8:143216685-143216707 AGCTCTGGGACAGCAGGCAGAGG + Intergenic
1049591146 8:143463318-143463340 GGCTCTGGGACAGCCGCTCCTGG - Intronic
1049741718 8:144244234-144244256 AGCGCTGGACGAGCAGGCCCGGG + Exonic
1050010828 9:1184431-1184453 AGACCTGGGAGAGCAGCTCTAGG + Intergenic
1052326086 9:27218053-27218075 AGGTCTGGGAGAGGAGCCACAGG - Intronic
1053121214 9:35548466-35548488 CTCCCTGGGAGAGCAGGCCCTGG - Exonic
1057142899 9:92738289-92738311 AGGGCTTGAAGAGCAGCCCCAGG + Intronic
1057185251 9:93053836-93053858 AGCATGGGGGGAGCAGCCCCTGG + Intergenic
1057770345 9:97961870-97961892 AGCTTTAGGAGAGCAGACCATGG + Intergenic
1057943597 9:99305855-99305877 AGATCTGGGACTGCAGCTCCCGG - Intergenic
1060231318 9:121827457-121827479 AGCTCTGGGACTGGAGCCCAGGG + Intronic
1060237813 9:121878494-121878516 AGCTCTGGGAATCCATCCCCAGG - Intronic
1060518492 9:124280530-124280552 AGTGCTGGGACAGCAGCCCAGGG - Intronic
1061037761 9:128122893-128122915 GGCTCGGGGACAGCAGGCCCCGG + Intronic
1061248691 9:129414272-129414294 GGCTCCGGGAGGGCAGCCCCGGG - Intergenic
1061534537 9:131239418-131239440 AGCTCTGTGAGGGCAGTGCCAGG + Intergenic
1062016090 9:134292077-134292099 AGCCCTGGCAGAGGAACCCCAGG - Intergenic
1062351514 9:136141961-136141983 AGCTGAGGGTGAGCAGCCTCCGG - Intergenic
1062357900 9:136173700-136173722 ACCTCTGTTACAGCAGCCCCAGG + Intergenic
1062379451 9:136280280-136280302 GGCACTGAGAGAGCAGGCCCCGG - Intergenic
1062432735 9:136533191-136533213 AGCTCCCGGGGTGCAGCCCCTGG - Intronic
1062457590 9:136646790-136646812 AGCTCTAGGAAATCAACCCCAGG + Intergenic
1062489211 9:136796418-136796440 AGATGTGGAAGAGCAGACCCAGG + Exonic
1203744897 Un_GL000218v1:36197-36219 GGCTCTGGCCCAGCAGCCCCAGG + Intergenic
1203603392 Un_KI270748v1:37168-37190 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1190053639 X:47169901-47169923 AGCTCTGGGAGGCCAGCCATGGG + Intronic
1192213368 X:69141711-69141733 ATCTTTGGGAAAGCAGACCCTGG - Intergenic
1192273113 X:69602397-69602419 AGATCTGGAAGGGCAGCCCAGGG + Intergenic
1197879189 X:131146943-131146965 AGCTCTGGGAAAGCAGGGACAGG - Intergenic
1199927210 X:152480269-152480291 AGATCTGGGAATGCAGCTCCCGG - Intergenic
1200912907 Y:8546788-8546810 ATCTGGGAGAGAGCAGCCCCGGG - Intergenic
1201278623 Y:12321645-12321667 ATGACTGGGAGAGCAGCCTCAGG - Intergenic
1201900694 Y:19044176-19044198 AATTCTGAGAGGGCAGCCCCAGG - Intergenic
1202385459 Y:24322223-24322245 GGCTCTGGCAGAGGAGTCCCAGG + Intergenic
1202485327 Y:25347905-25347927 GGCTCTGGCAGAGGAGTCCCAGG - Intergenic