ID: 953388913

View in Genome Browser
Species Human (GRCh38)
Location 3:42523278-42523300
Sequence AGGCCTTGACCACAATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953388907_953388913 23 Left 953388907 3:42523232-42523254 CCCATGGTGACTGCCATTTTGAT 0: 1
1: 0
2: 1
3: 17
4: 150
Right 953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 140
953388908_953388913 22 Left 953388908 3:42523233-42523255 CCATGGTGACTGCCATTTTGATA 0: 1
1: 0
2: 0
3: 17
4: 169
Right 953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 140
953388910_953388913 -2 Left 953388910 3:42523257-42523279 CCTTGAGAGCAGCTTGCTATGAG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 140
953388909_953388913 10 Left 953388909 3:42523245-42523267 CCATTTTGATATCCTTGAGAGCA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953388913 Original CRISPR AGGCCTTGACCACAATCCCA GGG Intronic
900081465 1:861231-861253 AGGCCACGACCACAAGCACAGGG - Intergenic
905430986 1:37923404-37923426 AGGACTTGACCACTATACTAAGG + Intronic
907388662 1:54142070-54142092 GGGCCCTGACCACATTCCCTGGG - Intronic
907746899 1:57222623-57222645 GGGCCTTGTTCACAATGCCAGGG + Intronic
915031386 1:152883088-152883110 AGGCTTTTCTCACAATCCCAAGG + Intronic
920187893 1:204173126-204173148 AGTCCCTGACCACCAACCCAGGG - Intergenic
922207502 1:223461342-223461364 AGGCCTTGAACACCAGGCCAAGG - Intergenic
922871043 1:228902200-228902222 AGACACTGGCCACAATCCCAGGG - Intergenic
1063250058 10:4264269-4264291 AGGCAGTGCCCCCAATCCCAGGG - Intergenic
1066062895 10:31739884-31739906 ACGCCTTAACCACACTCCCCAGG + Intergenic
1067474187 10:46555725-46555747 AGGATTTGCCCACAATCCCTGGG + Intergenic
1068097986 10:52515929-52515951 AGCCCTTGGACAAAATCCCATGG - Intergenic
1072168202 10:92834242-92834264 AGGGCTTGCCCACAAACCCAAGG - Intergenic
1074111706 10:110427339-110427361 AGGCCTTGTCCCCTCTCCCATGG + Intergenic
1074189721 10:111125141-111125163 AGGCCATGAACACATACCCAGGG + Intergenic
1074309947 10:112313511-112313533 CAGCACTGACCACAATCCCAGGG - Intergenic
1075416800 10:122270323-122270345 AGGCCTGGACCACCACCCCAGGG - Intergenic
1075855034 10:125622666-125622688 AGCCATTGACCTTAATCCCAGGG + Intronic
1077649039 11:3952936-3952958 AGGCCTTGACCTCAATAACATGG - Intronic
1077884915 11:6380226-6380248 AGGCCTCAACCACTATCCAAGGG + Intergenic
1079019610 11:16898659-16898681 AGGCCTTGTCCACACTTCCTAGG + Intronic
1081507846 11:43736576-43736598 GGGCATTTTCCACAATCCCATGG - Intronic
1082105510 11:48217139-48217161 AGGCCATCACCACAATCAAAAGG - Exonic
1083425250 11:62581035-62581057 AGGACTTGCCCACAGTCACATGG + Intronic
1085415308 11:76315634-76315656 AAGCCCCGACCACAACCCCAAGG + Intergenic
1088626146 11:111732062-111732084 AGGCCTGCACCCCAAACCCAGGG + Intronic
1090274539 11:125410246-125410268 AGGCTGGGACCACAATCCCCTGG - Exonic
1095440164 12:42230417-42230439 TGGCCTTGAACACTATCCTAAGG + Intronic
1098329780 12:69341193-69341215 AGGACTTGACCCCAATCCAAAGG - Intergenic
1099241289 12:80142579-80142601 ATTCCTTCACCACTATCCCAAGG + Intergenic
1101986603 12:109451907-109451929 TGGCCTTCAGCAGAATCCCAGGG - Intronic
1102629276 12:114263172-114263194 TGGCTCTGACCACCATCCCAAGG - Intergenic
1102740226 12:115200434-115200456 AGGTCTTGACCAAAGTCCCTTGG - Intergenic
1103447288 12:121002395-121002417 AGGCCTTTTCCTGAATCCCAGGG - Exonic
1105680518 13:22722641-22722663 AGACCTTAAAGACAATCCCATGG - Intergenic
1107446279 13:40472675-40472697 AGTGGTTGACCACAGTCCCAGGG + Intergenic
1115211326 14:30970000-30970022 AGTCATGGACCACAGTCCCAGGG + Intronic
1121616037 14:95314485-95314507 ACTCCTTGACCACCTTCCCAGGG + Intronic
1122691397 14:103533581-103533603 GGGCCTGGACCATAGTCCCAGGG + Intronic
1125548778 15:40528701-40528723 AGGCCTTGTCCACAAGCGAATGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128316281 15:66661452-66661474 AGGCCTAGACCAGGAGCCCAAGG + Intronic
1128696027 15:69763509-69763531 AGCCATGGACCACAATCCCGAGG + Intergenic
1129165561 15:73775293-73775315 AGGCCTTGACCACAGACCCGCGG - Intergenic
1132331085 15:101012951-101012973 AGGCCTTGTCCACAGCCCCTGGG + Intronic
1133220865 16:4318659-4318681 AGGCCTGGACCCCATTTCCAAGG + Intronic
1134681308 16:16127690-16127712 AGGCCTTGGTCTCACTCCCAAGG - Intronic
1135294786 16:21269834-21269856 AGGCCTGGACCCCAGCCCCAAGG + Exonic
1135752907 16:25071031-25071053 GGGCCCTGAACACAAACCCAGGG - Intergenic
1137456422 16:48621391-48621413 GTGCCTTGCCCACAGTCCCATGG + Intergenic
1138063320 16:53914012-53914034 AGGCCCTGGCCACAGTCCCTCGG + Intronic
1138599650 16:58046988-58047010 GGGGCTTGACCTCAATGCCAAGG + Intergenic
1139214424 16:65113383-65113405 AGGACTTGCCCAAGATCCCACGG - Intronic
1139340063 16:66262671-66262693 GGGCCTTGAGCACAGGCCCAGGG - Intergenic
1139608872 16:68040381-68040403 AGGGCTTGAAAACAATCCTAAGG - Intronic
1140917848 16:79509621-79509643 AGGCCTTGGCCAATATCCCCAGG - Intergenic
1141410338 16:83828754-83828776 AGGCCTTCACTCCAGTCCCAGGG - Intergenic
1142137727 16:88459368-88459390 AGGCCTTGCCCATAGTTCCACGG - Intronic
1144960579 17:19042051-19042073 AGGACTTGCCCACGGTCCCAAGG + Intronic
1146566042 17:33914022-33914044 AGGGCGAGACCATAATCCCAGGG + Intronic
1149237776 17:54612977-54612999 AGGCCTGGACCATAATTCAATGG - Intergenic
1149515117 17:57275374-57275396 AACCCTTGCCCTCAATCCCAAGG - Intronic
1152450957 17:80379673-80379695 AGGCATTGACCACAAACCTCGGG + Exonic
1153770080 18:8408256-8408278 AGGGCTTCACCACACTCCCCTGG - Intergenic
1153903624 18:9640659-9640681 AGGTCTTGGCCACAATGCCCTGG - Intergenic
1155046681 18:22109236-22109258 AGTTCTTGACCACAAGCCAAGGG - Intergenic
1155713827 18:28914608-28914630 AGGCCTTACCTACAATCTCAAGG - Intergenic
1156045282 18:32871021-32871043 ATGCCTGGACCAGATTCCCAGGG + Intergenic
1159830139 18:73266988-73267010 AGGCCTTGATTAGAATTCCATGG - Intergenic
1161334167 19:3703215-3703237 TGGCCTTAAGCACATTCCCATGG - Intergenic
1161383175 19:3977239-3977261 AGGCCTTGACCACAAACATGGGG + Exonic
1167271724 19:48509990-48510012 ACGCCATGACCAGCATCCCATGG - Intronic
1168137230 19:54359921-54359943 AGACCTTGACTCCAAGCCCAGGG + Intronic
1168160847 19:54509164-54509186 AGACCTTGACTCCAAGCCCAGGG - Intronic
926158629 2:10472622-10472644 AGGCCTTCACCCCAAGCCCGTGG - Intergenic
927153152 2:20207068-20207090 AGGCCCTGGCCACAGGCCCACGG + Intronic
927651606 2:24916900-24916922 AGGCATTGACCCCCAGCCCAGGG - Intronic
927747028 2:25632633-25632655 AGGCCATGCACACCATCCCATGG - Intronic
927760512 2:25749239-25749261 AAGAGTTGATCACAATCCCAGGG - Intronic
927760678 2:25750863-25750885 AAGAGTTGACCACAATCACAGGG - Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
929874349 2:45784210-45784232 TGGCCTTGGCCAGGATCCCAAGG + Intronic
930268225 2:49224859-49224881 GGCCCTTGGCCACCATCCCAGGG + Intergenic
934152474 2:89160548-89160570 AGGGCTTGACCAAGACCCCAGGG + Intergenic
934761567 2:96859628-96859650 GGGCCTCCCCCACAATCCCAGGG - Intergenic
936670123 2:114646963-114646985 GGGCCTTGACTAAAGTCCCATGG + Intronic
937229785 2:120390865-120390887 CCGCCTTGGCCACCATCCCAGGG - Intergenic
946866276 2:224043852-224043874 TGGCCTTGGCCACCATCCCAAGG + Intergenic
947991585 2:234492258-234492280 AGGACTTGAGCAAAATCACAGGG + Intergenic
948481299 2:238252131-238252153 AGGCCCCGCCCTCAATCCCAAGG - Intronic
948537050 2:238654132-238654154 ACTCCTTGACTGCAATCCCATGG - Intergenic
1168934093 20:1648023-1648045 GGGCCTTGTCCACAGTCACATGG - Intronic
1173616069 20:44403711-44403733 AAGCCTGGACCATAAACCCATGG + Intronic
1173732606 20:45339132-45339154 AGTGATTGCCCACAATCCCACGG - Intronic
1174325459 20:49775277-49775299 AGGCCTTGAGCCCACTCCCTGGG + Intergenic
1175797757 20:61783517-61783539 GGGCCTTGAGAACTATCCCAAGG - Intronic
1181751935 22:24994923-24994945 AGGCCTTGTCTCCCATCCCAAGG - Intronic
1184189790 22:42887042-42887064 GGGCCTTTGCCAGAATCCCAGGG - Intronic
1184244240 22:43227850-43227872 AGGGCTTGTCCAGAGTCCCACGG - Intronic
1184506664 22:44907882-44907904 GGGCCAGGAACACAATCCCACGG + Intronic
1184525311 22:45019261-45019283 AGGCCTTGAACCCACTTCCAAGG - Intergenic
1184658795 22:45955823-45955845 GGGCCTTGTCCACAGTCCCTGGG - Intronic
949537582 3:5007632-5007654 CAGCCTGGACCACAACCCCAGGG + Intergenic
952684114 3:36130208-36130230 AGGCCTGGTCCCCAATTCCAGGG + Intergenic
953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG + Intronic
959295726 3:104531564-104531586 AGGCATTCACCACAATGCCAGGG - Intergenic
960394455 3:117119208-117119230 TGGCCTTGAACACAACCCCTTGG + Intronic
963938045 3:151074514-151074536 AGGCATTCACCACACTGCCAAGG - Intergenic
971473647 4:27052344-27052366 AGTGCTTAAGCACAATCCCAGGG - Intergenic
972991256 4:44824525-44824547 AGTCGTGGGCCACAATCCCAGGG - Intergenic
975632731 4:76419001-76419023 AGGCCTGGACCTCAATCCCCAGG + Intronic
977249593 4:94675142-94675164 AGTCATTGAACACAATCCCCAGG - Intergenic
982177980 4:152724572-152724594 AGTCCTTGACCAGACTCTCATGG - Intronic
987918520 5:24248451-24248473 AGGCCTTGAACACAGACACAGGG - Intergenic
990699051 5:58455759-58455781 AGGCCTTGAAGACAGTACCATGG - Exonic
995591240 5:113702105-113702127 AAACCTTGACCACAATCCACAGG - Intergenic
996333397 5:122356689-122356711 AGGCATTGAGGACAAGCCCAAGG - Intronic
998138424 5:139686785-139686807 AAGCCATGACCACACACCCAGGG - Intergenic
1000166586 5:158655203-158655225 AGGACTTGTCCACAGTCACATGG - Intergenic
1004002492 6:11607891-11607913 AGCCCCTGCCCACAAGCCCAAGG - Intergenic
1007212710 6:40208395-40208417 AGGCCTCCCCCACAGTCCCAAGG + Intergenic
1009496950 6:64361237-64361259 AGGCCCTGTCCAAAATCCTATGG + Intronic
1018926327 6:168209440-168209462 AGGCCTAGCCCACCATCCCCAGG - Intergenic
1019274410 7:168335-168357 AGGCCCTGGCCAGAGTCCCATGG + Intergenic
1019492451 7:1321725-1321747 AGGCCTTGACCAGCTGCCCAAGG - Intergenic
1022518196 7:30988825-30988847 AGGCCCTGTGCACATTCCCATGG + Intronic
1024832246 7:53474322-53474344 AGGTCTTGCCCACATTCCAAGGG - Intergenic
1025854349 7:65264789-65264811 AGGCCGCGAACACAGTCCCACGG - Intergenic
1027174878 7:75896943-75896965 AGGCCTTGACGTGAGTCCCAGGG + Intergenic
1029943495 7:104506477-104506499 AGGACTTGACCACAATCTAGTGG - Intronic
1032989340 7:137374551-137374573 AGGCCATGACCCCAATGCAAAGG - Intergenic
1034078890 7:148258446-148258468 AGGCCTTGACCCCAGTATCAAGG - Intronic
1035006075 7:155662145-155662167 AAGCCATGACAACCATCCCAGGG - Intronic
1035523798 8:296242-296264 AGGCCACGACCACAAGCACAGGG + Intergenic
1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG + Intergenic
1036788448 8:11702930-11702952 AGGAGTTGGCCACGATCCCATGG + Intronic
1038867168 8:31451938-31451960 AGGCCTTAATCACATTCACAAGG - Intergenic
1039343276 8:36674551-36674573 AGGCCTTGACCACCATGCTAAGG + Intergenic
1042315533 8:67422456-67422478 AGGCCTTGCTCAGAATCCTATGG + Exonic
1046632133 8:116631590-116631612 AGGCCTTCAGCCCAATCCTAGGG + Intergenic
1046680266 8:117161762-117161784 ATGCCTTGGCCACAATCACAAGG + Exonic
1051607072 9:18926730-18926752 AGGCCCTGAGCCCAAGCCCAAGG + Intergenic
1053110780 9:35457932-35457954 AGTCCTGGGCCACAATCCCAGGG - Intergenic
1058741657 9:107948845-107948867 TGACCTTGACCACAATGGCATGG + Intergenic
1060553593 9:124497201-124497223 AACCCTTTACCACAATCCAATGG + Intronic
1186718679 X:12279708-12279730 AGGCCTGGTCCACCATGCCAGGG + Intronic
1190939727 X:55028496-55028518 AGGTCTTCTCCACCATCCCAAGG - Intronic
1193606219 X:83570286-83570308 AGGCCTTGACCACAGGCTGAAGG - Intergenic
1193668564 X:84355011-84355033 AGGCATTGAACTCAACCCCAAGG + Intronic
1195980638 X:110574082-110574104 AATGATTGACCACAATCCCAAGG - Intergenic
1199978621 X:152908769-152908791 TGGCCCTGGCCACACTCCCAGGG - Intergenic
1200064603 X:153498432-153498454 TGGCCTTGACTGCCATCCCATGG + Intronic