ID: 953389391

View in Genome Browser
Species Human (GRCh38)
Location 3:42525777-42525799
Sequence AGCCCTACTCCCACCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953389391_953389395 28 Left 953389391 3:42525777-42525799 CCAGGGTTGGTGGGAGTAGGGCT 0: 1
1: 0
2: 1
3: 20
4: 253
Right 953389395 3:42525828-42525850 CAGCCAGGTCCCCATGCTCCCGG 0: 1
1: 0
2: 5
3: 80
4: 547
953389391_953389393 13 Left 953389391 3:42525777-42525799 CCAGGGTTGGTGGGAGTAGGGCT 0: 1
1: 0
2: 1
3: 20
4: 253
Right 953389393 3:42525813-42525835 TGTTCCAAGCAGAGACAGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953389391 Original CRISPR AGCCCTACTCCCACCAACCC TGG (reversed) Intronic
900104534 1:976702-976724 GCCCCCACCCCCACCAACCCCGG + Intronic
900154851 1:1199807-1199829 AGCCCCACCCCCTGCAACCCAGG + Intergenic
900484158 1:2913638-2913660 CGCCTTCCTCCCACCACCCCTGG + Intergenic
900557729 1:3288636-3288658 AGCCCCTCCCCCACCACCCCAGG + Intronic
900778533 1:4602051-4602073 CTCCCTACTCCCACCCAGCCTGG + Intergenic
900805860 1:4767992-4768014 ACCCCTAATCCCACCAACAATGG - Intronic
901264722 1:7902024-7902046 AGCCCTGCTCTCAGCCACCCCGG - Intergenic
901605368 1:10454983-10455005 AGCCGTACTCCCAGCTACTCAGG - Intergenic
902974733 1:20080646-20080668 AGCCCTACTTCCCCTCACCCTGG - Intronic
902996609 1:20230387-20230409 TGCCCTCTTCCCACCACCCCAGG + Intergenic
903368450 1:22819039-22819061 AGTCCTAGTCCCACCTCCCCCGG + Intronic
904296718 1:29524216-29524238 TGTGCTACTCCCAGCAACCCAGG + Intergenic
904538202 1:31215279-31215301 AGCAGTACTCCCCCCAACCCAGG + Intronic
905012762 1:34758407-34758429 CGCCCTCCTCCCTCCAACCCTGG - Exonic
905266048 1:36755140-36755162 ACCTCTACTCCCACCAGCCTAGG - Intergenic
906745390 1:48217880-48217902 AGCCCTCCTCCACCAAACCCTGG + Intergenic
907517061 1:54999359-54999381 AGCCCCACTACCACCTACCTTGG - Exonic
910803269 1:91165735-91165757 AGATCCCCTCCCACCAACCCTGG - Intergenic
911091209 1:94018814-94018836 CTCCCTACCCCCACCAACCTTGG + Intronic
912746869 1:112252426-112252448 AGCCCAGCTCCAACCACCCCAGG + Intergenic
912808542 1:112775522-112775544 AGCCTTTCTCCCAACAGCCCTGG + Intergenic
912834739 1:112986216-112986238 AGCTCTACTCCCCCAACCCCTGG - Intergenic
913153016 1:116064468-116064490 AGCAATAATCCCACCAACTCGGG - Exonic
913374460 1:118135196-118135218 AGCCCTCCTCTCACCAAACCAGG + Intronic
914725245 1:150321713-150321735 ACCTCTTCTCCCACCAAACCAGG - Intronic
914858728 1:151370008-151370030 AGCCCTCCTCCCACCCTCCCGGG - Intronic
918141517 1:181724002-181724024 AGCCCTACCCCCACAACCCCTGG - Intronic
919897499 1:202018417-202018439 ACCCCGACTCTCACCAGCCCAGG + Intergenic
923803370 1:237232256-237232278 AGCCCCACCCCCAACACCCCGGG + Intronic
924353378 1:243142341-243142363 AGCACTGCTGCCACCACCCCTGG - Exonic
1063049293 10:2429332-2429354 CCCCATACTCCCACCAACACTGG - Intergenic
1063385450 10:5613688-5613710 AGCCCTACTCCAGTGAACCCCGG + Intergenic
1064746388 10:18482633-18482655 ACCAGTACTCCCACCTACCCAGG - Intronic
1065285376 10:24182358-24182380 AGCCCTCCCCCCACCTCCCCGGG - Intronic
1066459508 10:35600960-35600982 AGCCCTTTTCCCACCAGCCCTGG + Intergenic
1069006367 10:63321892-63321914 AGCCTTTCTTCCACCAACCTAGG + Intronic
1069983539 10:72268762-72268784 AGCCCTACTTCTACCAACAAGGG + Intergenic
1075075716 10:119349031-119349053 CGCCCTCCTCCCACCCACCGTGG + Intronic
1075735770 10:124663860-124663882 TCACCTCCTCCCACCAACCCAGG + Intronic
1076673105 10:132133843-132133865 CAGCCTCCTCCCACCAACCCAGG - Intronic
1077716222 11:4583323-4583345 ATCCCTCCTCTCACCAGCCCTGG - Intergenic
1078084390 11:8224993-8225015 AACCCTACACTCACCAACACAGG - Intronic
1078202177 11:9193436-9193458 AGCCCTTCTCTCCCCAATCCTGG + Intronic
1078892762 11:15572460-15572482 CACCCTACCCCCACCCACCCTGG + Intergenic
1081390293 11:42521471-42521493 AGACCTACTCCCCCAAACCATGG + Intergenic
1081796484 11:45824036-45824058 AGCCCTCCTCCCACACACCGTGG + Intergenic
1082070294 11:47934070-47934092 AACCCTCCTCCCAGCTACCCGGG + Intergenic
1082821263 11:57546081-57546103 GGCCACCCTCCCACCAACCCAGG - Intronic
1083158757 11:60841950-60841972 AGCCCCACTCTCCCCAACCCCGG + Intergenic
1083720968 11:64603370-64603392 GGCCCATCTCCCACCAGCCCTGG - Intergenic
1083721674 11:64606641-64606663 CGCCCTTCTCCCACCGACTCTGG + Exonic
1084042154 11:66548355-66548377 ATCCCTACCCCCACCCACCCGGG + Intronic
1084758612 11:71254036-71254058 ACCCCCACTCCCTGCAACCCAGG - Intergenic
1086520207 11:87660503-87660525 ATCCCTTCTCCCACTAGCCCGGG + Intergenic
1091798328 12:3309701-3309723 AGACCTCCTCCCAGGAACCCAGG - Intergenic
1092070804 12:5629832-5629854 AGCCCCCTTCCCACCACCCCAGG + Intronic
1092340258 12:7669979-7670001 CGCCCACCTCCCACCCACCCTGG + Intergenic
1092745475 12:11668614-11668636 AGCCCTTCTCCGACCCAGCCAGG - Intronic
1096076701 12:48810499-48810521 AGCCCACCTCCCTCCACCCCAGG + Intergenic
1096575281 12:52548942-52548964 AGCCCTACCCCACCCCACCCTGG + Intronic
1097183907 12:57186157-57186179 AGCCCAACGCTCACAAACCCAGG + Intronic
1100638276 12:96456880-96456902 TGCCTTACTCCCAGCAGCCCAGG - Intergenic
1102392763 12:112562917-112562939 ATCCCTACTGCCACCATCCTGGG + Intergenic
1102893836 12:116582615-116582637 AGCCATCCTCCCACCATGCCTGG + Intergenic
1104143344 12:126009084-126009106 TGCCCTGCCCCCACCAGCCCCGG + Intergenic
1104785985 12:131448273-131448295 AGCCCTGCTCCCACCAAGGGAGG - Intergenic
1105213682 13:18272427-18272449 AGCCCCAGGCCCACCAAGCCTGG - Intergenic
1105418499 13:20232630-20232652 AGCCCTACCCCCTGCATCCCCGG - Intergenic
1107031107 13:35854518-35854540 AGCCCATCACCCACCAGCCCAGG - Exonic
1107802278 13:44119908-44119930 AGCCCTAGTCCTACCAGCCCTGG + Intergenic
1109995925 13:70125898-70125920 TGCCCTCCTCCCACAACCCCCGG - Intergenic
1113492952 13:110706313-110706335 CGCCCTCCTCCCTCCACCCCGGG - Intronic
1113880752 13:113624129-113624151 AGCCCTGTTCCTGCCAACCCTGG + Intronic
1114493650 14:23118546-23118568 AGCCCTCCTCCCTCCTGCCCGGG - Intronic
1114929626 14:27451009-27451031 AGCCCTACACCTATAAACCCTGG - Intergenic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118505076 14:66402419-66402441 AACCCTTCTCCCACTATCCCTGG + Intergenic
1122084716 14:99291565-99291587 AACCCTACTGCCACCTCCCCAGG + Intergenic
1122699922 14:103581456-103581478 GGTCCTACTCCGACCAGCCCAGG - Intronic
1123073364 14:105652824-105652846 CGCACTGCTCCCACCCACCCTGG - Intergenic
1123093289 14:105751591-105751613 CGCGCTGCTCCCACCCACCCTGG - Intergenic
1126096520 15:45094537-45094559 AGTCCCACTCCCTCCCACCCTGG - Intronic
1130368645 15:83263878-83263900 AGGCCTCCTCCCAGCTACCCTGG - Exonic
1130876006 15:88015331-88015353 AGACCTGCTCCCTCCACCCCGGG + Intronic
1131262136 15:90893021-90893043 AGCTCTTCTCCCATCATCCCTGG + Intronic
1132776303 16:1596621-1596643 AGCTCAACTTCCACCAACTCAGG + Intronic
1133363887 16:5195942-5195964 AGCCATGCTCCCTCCAACCCAGG + Intergenic
1133666798 16:7976140-7976162 ATCCCTCCTCGCACCACCCCTGG - Intergenic
1135645695 16:24159858-24159880 ACCCGTAGTCCCACCTACCCAGG + Intronic
1136393423 16:29979344-29979366 ACTCCTACTCCCAACATCCCTGG - Intronic
1136517213 16:30775361-30775383 TGTCCTGCTCCCACCGACCCCGG + Exonic
1137618168 16:49858742-49858764 AGCCCAACTCCGTCCATCCCTGG - Intergenic
1138227048 16:55304937-55304959 AGCTCTACACCCACTAACTCTGG - Intergenic
1139348451 16:66320287-66320309 AGCCCAACTCCAACTAAGCCAGG + Intergenic
1141693607 16:85610007-85610029 AGCCCTACCTCCACAAGCCCTGG - Intergenic
1141931551 16:87207942-87207964 ACCCCTACCCCCACCACCGCAGG - Intronic
1142764897 17:2059313-2059335 ACCCCCGCTCCCACCCACCCCGG + Exonic
1143169719 17:4921505-4921527 AGCCGTCCTCCCACCATACCTGG + Intergenic
1144180377 17:12746039-12746061 AGGCCCACTCCCACCTAACCTGG + Exonic
1144958159 17:19030095-19030117 ACCCCTACATCCACCTACCCAGG + Intronic
1144976999 17:19144423-19144445 ACCCCTACATCCACCTACCCAGG - Intronic
1147020789 17:37531072-37531094 GGCCCTATTCCTACCAAGCCAGG + Intronic
1147161754 17:38572733-38572755 GCCCCTACTCCCACCCGCCCGGG + Intronic
1149572901 17:57686182-57686204 AGCCTCACTCCCACCCTCCCAGG - Intergenic
1149997711 17:61413335-61413357 AGCCCCACCCCCTCCAACTCTGG - Intergenic
1150231166 17:63551295-63551317 CCCCCTACTCCCACCCCCCCCGG + Intronic
1150324421 17:64244843-64244865 CTCTCTACTCCCCCCAACCCTGG + Intronic
1150408450 17:64922268-64922290 AGCCCTACGCCCTCCAGCCTGGG - Intergenic
1151815417 17:76469252-76469274 AGCCCTCCTCGAACCAGCCCAGG - Exonic
1152694751 17:81738542-81738564 GGCTCTTCTGCCACCAACCCTGG + Intergenic
1154103555 18:11499772-11499794 CACCCTACTCCCCCCACCCCAGG + Intergenic
1154476997 18:14770596-14770618 ACCCTTACTCCTACCAATCCTGG - Intronic
1154481378 18:14829532-14829554 ACCCTTACTCCTACCAATCCTGG - Intronic
1155046755 18:22109636-22109658 AGCCCTACTCCCATCTCCCCAGG - Intergenic
1156457552 18:37303250-37303272 TTCCCTCCTCCCACCTACCCAGG + Intronic
1157869738 18:51218892-51218914 AACCCTCCTGCCAACAACCCTGG - Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1159285978 18:66352384-66352406 AGCCTTACTCTCCTCAACCCTGG - Intergenic
1161115171 19:2492787-2492809 AGTTCTAATCCCACCAACCCTGG - Intergenic
1161159355 19:2753242-2753264 AGCACTAGACCCAGCAACCCTGG + Intergenic
1162304192 19:9861589-9861611 AGCCATACTCCTTCCAACACTGG + Intronic
1166251421 19:41573441-41573463 AGCCCTGCTCCTCCCAACCAGGG + Intronic
1166306388 19:41938886-41938908 AGCCCTCCTCCCTCAGACCCAGG + Intergenic
1166306595 19:41939480-41939502 AGCCCTCCTCCCTCAGACCCAGG + Intergenic
1166502608 19:43353221-43353243 GGCCCTCCTCCCTCCGACCCAGG - Intergenic
1166679091 19:44756596-44756618 AGCCCTCCTCCCTCAGACCCAGG - Intronic
1166679104 19:44756632-44756654 AGCCCTCCTCCCTCAGACCCAGG - Intronic
1166723689 19:45012295-45012317 AGCCCCAGTCCCACCCGCCCGGG - Intronic
1167462303 19:49632073-49632095 TGCTCTACTCGCACCCACCCTGG - Intergenic
1167630950 19:50625866-50625888 AGCCCTCCTCCCTCAGACCCAGG + Intronic
1167669055 19:50839157-50839179 GCCCCTCCTCCCACCGACCCAGG - Intergenic
1167690158 19:50980182-50980204 AGCCCTCCTCCCTCAGACCCAGG - Intronic
1168306334 19:55438113-55438135 AGCCCTCCTCCCTCAGACCCAGG + Intronic
925175494 2:1780984-1781006 AGCACTAGTCCTACCCACCCCGG + Intergenic
925389591 2:3486296-3486318 AGCCTCACTCCCTCCACCCCAGG + Intergenic
925987164 2:9225863-9225885 AGCCACACACCAACCAACCCTGG - Intronic
927112288 2:19872100-19872122 AGCCCTGCTCACACCGAGCCAGG + Intergenic
929595034 2:43170447-43170469 TGCCCTCCTTCCACCATCCCAGG - Intergenic
929673330 2:43897744-43897766 ATCCCTGCTGCCACCCACCCAGG + Intronic
929853505 2:45614688-45614710 AGCCCTACTGCCAGCTTCCCTGG + Intergenic
936078351 2:109415936-109415958 AGCCCTGCTCCCATGAATCCAGG - Intronic
942045367 2:172096558-172096580 TCCCCTTCTCCCCCCAACCCCGG - Intergenic
944260713 2:197673217-197673239 AAGCCTCCTCCCAGCAACCCAGG + Intronic
947138217 2:226996008-226996030 TGTCCTACTCTCCCCAACCCCGG + Exonic
947870019 2:233429834-233429856 TGTTCTTCTCCCACCAACCCAGG + Intronic
948696691 2:239736439-239736461 AGCCCTGCTCTCTCCACCCCGGG + Intergenic
948867635 2:240783667-240783689 AGCCCTCCTGCCACCCACTCTGG + Intronic
1169262728 20:4149581-4149603 AGCCCGGCTCCCGCCAAGCCCGG - Intronic
1170757951 20:19221416-19221438 AGCCCTGCTCCCTGGAACCCAGG + Intronic
1172589230 20:36105822-36105844 AGCCCCCCTCCCACCAGCCCAGG - Intronic
1172621429 20:36320460-36320482 AGCCCCACTGCCACCTGCCCTGG - Intronic
1174280275 20:49434226-49434248 ACCCCTCCTCCCACTAACCACGG + Intronic
1174448542 20:50606472-50606494 AGCCCTCCTGCCTCCAACCATGG + Intronic
1174883025 20:54301975-54301997 AGCCATGCTCCCAGCATCCCAGG - Intergenic
1175219178 20:57407258-57407280 AGCCCTACACCCCACATCCCCGG - Intronic
1175400712 20:58698502-58698524 TGCCCCACCCCCAGCAACCCAGG - Intronic
1175790610 20:61737915-61737937 AGCCCTGCGCACACCTACCCTGG - Intronic
1176240964 20:64075687-64075709 AGCCCCACTCCCACCCTCACAGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176510376 21:7743710-7743732 AGATCCACTCCCACCAAACCTGG + Intergenic
1176783071 21:13222715-13222737 AGCTGTAGTCCCACCTACCCAGG + Intergenic
1176799229 21:13407074-13407096 ACCCTTACTCCTACCAATCCTGG + Intergenic
1178117822 21:29435721-29435743 ACCCCTCCCCCCACCATCCCTGG + Intronic
1178285902 21:31325157-31325179 AGCCGTAGTCCCACCTACTCAGG + Intronic
1178742467 21:35215043-35215065 AACTCTACTTCCACCAACCTCGG + Intronic
1178799288 21:35777354-35777376 AGTCCTAGTACTACCAACCCTGG - Intronic
1179946989 21:44685228-44685250 AGAGCTACTCCCTCCATCCCAGG - Intronic
1180185359 21:46136660-46136682 AACCCCATTCCCTCCAACCCTGG + Intronic
1180187296 21:46145979-46146001 TGCGCTCCCCCCACCAACCCCGG - Intronic
1180999388 22:19981028-19981050 AGCCGAACTCCTACCACCCCAGG + Intronic
1181065059 22:20301694-20301716 AGCCCTGCTCCCCCCATCTCTGG - Intergenic
1181150331 22:20878659-20878681 AGCGCTACTCCCAGTAATCCAGG - Intronic
1182904121 22:33921309-33921331 CGCCCTTCTTCCCCCAACCCCGG + Intronic
1183465757 22:37979710-37979732 TGCCCTCCACCCTCCAACCCTGG - Intronic
1183613502 22:38927288-38927310 AGCCTGAATCCCACCCACCCCGG - Intergenic
1184388239 22:44188246-44188268 AGCCCTGCCCCCAGCCACCCAGG - Intronic
1185062409 22:48613936-48613958 AGCCCGCTTCCCACCACCCCCGG + Intronic
951072741 3:18351386-18351408 AGCCCCTCTCCCACCACCCTTGG - Exonic
953284537 3:41593923-41593945 AGCCCCCCTTCCCCCAACCCCGG - Intronic
953389391 3:42525777-42525799 AGCCCTACTCCCACCAACCCTGG - Intronic
954295839 3:49674174-49674196 ACCCCTGCTCTCACCCACCCAGG + Exonic
954432096 3:50476252-50476274 AGCCCCACCCCAGCCAACCCGGG + Intronic
954645201 3:52127088-52127110 TGCCCCACTCCCAGCAGCCCTGG + Intronic
955118456 3:56030964-56030986 AGGCCTACTCCGATGAACCCTGG + Intronic
957171515 3:76743252-76743274 AGCCCTACTAAGCCCAACCCTGG + Intronic
960982985 3:123249336-123249358 AGTCCTACTCCCACCCTCCGGGG - Intronic
962479638 3:135787331-135787353 GGCCCTACCCCCAGCAACCAGGG + Intergenic
965099161 3:164274339-164274361 AGCCCTGCCCCTACAAACCCAGG + Intergenic
966574446 3:181483888-181483910 AGAAATACTCTCACCAACCCTGG + Intergenic
966925746 3:184643516-184643538 ACCCCTACTCCCCCCCACACAGG - Intronic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
968698029 4:2042197-2042219 AGCCCTGGACCCACCCACCCCGG - Intronic
968776457 4:2543780-2543802 AGCCCTGCACCCCCCACCCCGGG - Intronic
968949820 4:3684664-3684686 AGCACTCCTCCCACCAACACCGG + Intergenic
969311899 4:6357720-6357742 ACCCCTACCCCCACCCACCAGGG - Intronic
969723931 4:8908138-8908160 AGCCATACTGCCACCCAGCCTGG - Intergenic
970013854 4:11490675-11490697 AGCTGTAATCCCAACAACCCAGG - Intergenic
970432239 4:15999941-15999963 AGTCCAACTCCCACCGACTCCGG - Intronic
973896100 4:55414774-55414796 ATCCCTCCTCCCTCCACCCCAGG + Intronic
973903801 4:55506305-55506327 ACCCCTAGTCCCAGCTACCCAGG - Intronic
976515913 4:85966174-85966196 AGCCCTAATCCCATCAGGCCAGG + Intronic
979248559 4:118537961-118537983 AGCACTGCTGCCACCACCCCTGG + Intergenic
981212204 4:142120727-142120749 AGGGCTGCTCCCATCAACCCTGG - Intronic
985627198 5:995220-995242 AGCCCACCTGCCACCAACCCAGG - Intergenic
985750244 5:1669507-1669529 TGCCCTACTGCCACATACCCAGG - Intergenic
994267095 5:97730449-97730471 AACCCCACTCCCACCACCACCGG + Intergenic
995500487 5:112799818-112799840 AGCCACACTCCCTCCTACCCTGG + Intronic
995916094 5:117246631-117246653 AGACTTACTCCCACCCAGCCTGG + Intergenic
998082993 5:139292520-139292542 AGCTCAAATCCCTCCAACCCGGG + Intronic
999514266 5:152285294-152285316 AGGCCTACTACCATCAGCCCAGG - Intergenic
1002421740 5:179152597-179152619 AGCCCTACCCCCACCCCCACAGG + Intronic
1004756417 6:18615369-18615391 GGCCCTCCTCCCACCAGCTCAGG - Intergenic
1005501531 6:26432988-26433010 AGCCATACTACCAGCATCCCAGG + Intergenic
1006367265 6:33622798-33622820 AGCTAAACTCCCAGCAACCCTGG - Intronic
1006451738 6:34109389-34109411 AGCTCTGCCACCACCAACCCAGG + Intronic
1006452905 6:34115421-34115443 TGCCCAACTCCCACCAAAACTGG + Intronic
1007751931 6:44076253-44076275 AGGCCTGTTCCCACCACCCCAGG - Intergenic
1012480877 6:99665724-99665746 ACCCCTAAGGCCACCAACCCTGG + Intergenic
1015038382 6:128686121-128686143 AGGCCTGCTCCCAGAAACCCAGG - Intergenic
1016933044 6:149428111-149428133 ATCCCTTCCACCACCAACCCTGG + Intergenic
1017328709 6:153170972-153170994 ATCCCTACTCCCATAAACTCAGG - Intergenic
1019739374 7:2665079-2665101 AGCCCTGCCCACCCCAACCCTGG - Intergenic
1021729967 7:23586454-23586476 TGCTCCACCCCCACCAACCCGGG + Intergenic
1022533940 7:31084273-31084295 AGCCCTACCCTCACCACCTCTGG - Intronic
1023781154 7:43656567-43656589 AGCCCTAATCCCAGCTACTCGGG + Intronic
1023989488 7:45119585-45119607 TGCCCCTCTCCCACCAATCCTGG + Intergenic
1024709211 7:51996235-51996257 AGCCCTGCTCCCTCCCAGCCTGG + Intergenic
1028580796 7:92408136-92408158 AGCCCTAATCCCCCCAGCACGGG + Intergenic
1031073284 7:117186453-117186475 TGCCCTGCTCCATCCAACCCGGG - Intronic
1032075517 7:128833980-128834002 TGCCCCACTCCCACCTGCCCCGG - Intronic
1032096492 7:128940779-128940801 AGCTCTGCTGCCACCAACCCAGG - Intronic
1032552483 7:132797381-132797403 AGCTCTCCACCCCCCAACCCTGG + Intronic
1034443734 7:151101236-151101258 AGCCATTCCCCCACCAGCCCAGG - Intronic
1035058209 7:156050907-156050929 AGCCCTCCCCTCACCCACCCTGG + Intergenic
1035077753 7:156192146-156192168 AGACCTACGCCCAGCCACCCTGG + Intergenic
1036762460 8:11518771-11518793 TGCCCTCCTCTCACCATCCCTGG + Intronic
1038742144 8:30225322-30225344 GGGCTCACTCCCACCAACCCTGG - Intergenic
1040538542 8:48330650-48330672 AACTCTACTCCCAGCACCCCTGG - Intergenic
1041022130 8:53648565-53648587 CCCCCTACCCCCACCAACCCTGG - Intergenic
1045976969 8:108140111-108140133 AGCTCTACTCACTCCAAGCCTGG - Intergenic
1047586646 8:126280693-126280715 AGTCCTACTCCCAACACCCATGG - Intergenic
1048621481 8:136137727-136137749 AGCTGTACTCCCACCAACTTGGG + Intergenic
1049242185 8:141543660-141543682 TGCCCTGCGCCCACCCACCCAGG - Intergenic
1049346640 8:142142723-142142745 AGACCTACTCTCCCCAACCCTGG - Intergenic
1049877891 8:145038309-145038331 TGCCCTTCTCACACCAACCGTGG + Intergenic
1050733352 9:8734984-8735006 GGCCCTATTCCAACCAAACCAGG - Intronic
1055082275 9:72279185-72279207 AGCTCTACTTCCTCCACCCCTGG + Intergenic
1059949213 9:119444476-119444498 AGCCCTCATCCCTCCAGCCCTGG - Intergenic
1060886198 9:127154176-127154198 AGCGCTATTCCCACCAAGCCTGG - Intronic
1061520941 9:131117455-131117477 ACCCCTGCTCCCACCAACGGTGG - Intronic
1061928836 9:133821841-133821863 AGCCCAGCTCCCTCCACCCCAGG + Intronic
1062166511 9:135110373-135110395 AGCGCTACTCCCACCACCCCAGG + Intronic
1062285978 9:135772665-135772687 AGCCCGACTCCCACCCTCCATGG - Intronic
1062397026 9:136356728-136356750 AGCCCTACTCCTGGGAACCCCGG + Intronic
1203785194 EBV:123703-123725 AGACCTACTCCCTGCAACACAGG - Intergenic
1186424736 X:9455066-9455088 AGCCCACCTCACACCAACCTTGG - Intergenic
1187767196 X:22655331-22655353 AGCCTTAACCCCACCAAGCCGGG + Intergenic
1188060062 X:25590338-25590360 CACCCTACCCCCACCAACCAAGG - Intergenic
1188362563 X:29273711-29273733 TGCCCTACTCCCACCACTGCAGG - Intronic
1189845678 X:45134439-45134461 AGCCGACCTCCCACCAACCTTGG - Intergenic
1190803449 X:53813638-53813660 AGTCCTGGTCCAACCAACCCAGG + Intergenic
1190808796 X:53864146-53864168 AGCCCTACTCTCATCTAGCCTGG - Intergenic
1191035852 X:56026039-56026061 AGCCCTACTCCAGTCAAACCCGG - Intergenic
1191800913 X:65078155-65078177 AGCCCTAGTCCCATCAAACCTGG - Intergenic
1192796557 X:74428371-74428393 ATCCCTTCTCCCACCAATGCTGG - Intronic
1193962293 X:87940510-87940532 CCCCCTATCCCCACCAACCCTGG + Intergenic
1194709180 X:97214342-97214364 ACCTCTACTCCCACCTACTCAGG + Intronic
1196021435 X:110995176-110995198 AGCCCTACTAACCCCAACACTGG - Intronic
1196899031 X:120365403-120365425 AGCCCTCCTCCCCCCAACAAAGG + Intronic
1197891836 X:131276879-131276901 AGCCTTCCACCCACCATCCCAGG + Intronic
1198438047 X:136636328-136636350 AGCCCCACCCCCACCCTCCCAGG + Intergenic