ID: 953389721

View in Genome Browser
Species Human (GRCh38)
Location 3:42527216-42527238
Sequence ACCAGGGCGTTAGGGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953389715_953389721 -10 Left 953389715 3:42527203-42527225 CCTGTCTGTAGAAACCAGGGCGT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389707_953389721 13 Left 953389707 3:42527180-42527202 CCCACCCTAAGACACAGTCCTGC 0: 1
1: 0
2: 1
3: 19
4: 173
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389704_953389721 18 Left 953389704 3:42527175-42527197 CCCACCCCACCCTAAGACACAGT 0: 1
1: 0
2: 6
3: 33
4: 303
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389706_953389721 14 Left 953389706 3:42527179-42527201 CCCCACCCTAAGACACAGTCCTG 0: 1
1: 0
2: 2
3: 20
4: 286
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389714_953389721 -9 Left 953389714 3:42527202-42527224 CCCTGTCTGTAGAAACCAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389702_953389721 20 Left 953389702 3:42527173-42527195 CCCCCACCCCACCCTAAGACACA 0: 1
1: 0
2: 12
3: 102
4: 785
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389708_953389721 12 Left 953389708 3:42527181-42527203 CCACCCTAAGACACAGTCCTGCC 0: 1
1: 0
2: 0
3: 22
4: 181
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389709_953389721 9 Left 953389709 3:42527184-42527206 CCCTAAGACACAGTCCTGCCCTG 0: 1
1: 1
2: 1
3: 29
4: 473
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389711_953389721 -5 Left 953389711 3:42527198-42527220 CCTGCCCTGTCTGTAGAAACCAG 0: 1
1: 0
2: 2
3: 14
4: 151
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389703_953389721 19 Left 953389703 3:42527174-42527196 CCCCACCCCACCCTAAGACACAG 0: 1
1: 0
2: 4
3: 82
4: 675
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389710_953389721 8 Left 953389710 3:42527185-42527207 CCTAAGACACAGTCCTGCCCTGT 0: 1
1: 1
2: 7
3: 119
4: 713
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114
953389705_953389721 17 Left 953389705 3:42527176-42527198 CCACCCCACCCTAAGACACAGTC 0: 2
1: 0
2: 6
3: 33
4: 298
Right 953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG 0: 1
1: 0
2: 1
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953389721 Original CRISPR ACCAGGGCGTTAGGGGTCAG GGG Intronic
901807343 1:11747055-11747077 ACCAGGGCCTAAGGGGCCTGTGG - Intronic
903448894 1:23439372-23439394 CCCAGAGAGTCAGGGGTCAGGGG - Intronic
915132440 1:153704924-153704946 ACCAGGGAGTTTGGGGTTGGAGG + Intergenic
919776203 1:201195530-201195552 AGCAGGGCTTTAGGGGACAGGGG - Intronic
921277373 1:213533152-213533174 ACCAGGGAGTCAGGGCTCAGGGG + Intergenic
1065129240 10:22603731-22603753 ATCAGGGCTTAAGGGGGCAGTGG + Intronic
1065767102 10:29040365-29040387 ACCAGGGCTCTAGGGCTGAGTGG - Intergenic
1066486630 10:35852074-35852096 ACCAGTGGGTTTGGGGGCAGAGG + Intergenic
1067797025 10:49328050-49328072 ACCAGGGACTTACGGGTCATAGG + Intergenic
1070149003 10:73794030-73794052 ACCAAGGCCTTGGAGGTCAGAGG + Exonic
1070573145 10:77656740-77656762 AGCAGGGCCTTAGAGGTCACAGG + Intergenic
1071295238 10:84214654-84214676 AGCAGGGTGGTGGGGGTCAGGGG - Exonic
1072546224 10:96441571-96441593 ATCAAGGGGTTTGGGGTCAGGGG + Intronic
1073068052 10:100775583-100775605 GCCAGTGCCCTAGGGGTCAGAGG + Intronic
1073132011 10:101195759-101195781 AGAAGGACGTTAGAGGTCAGAGG - Intergenic
1075581224 10:123620045-123620067 ACCAGGGTTCTGGGGGTCAGAGG + Intergenic
1076443808 10:130498219-130498241 CCCAGGGGGTTTGGGCTCAGAGG + Intergenic
1077998248 11:7472307-7472329 ACCAGGGAGTGAGGTGACAGAGG - Intergenic
1078822626 11:14897354-14897376 ACCAGGGAGAGAGGGGCCAGAGG - Intergenic
1081702557 11:45161347-45161369 ACCAGGATGTTAGCGGACAGCGG - Intronic
1081933201 11:46886851-46886873 ATCAGGGAAGTAGGGGTCAGGGG - Intronic
1089794267 11:120967575-120967597 GCCATGGTGCTAGGGGTCAGAGG - Intronic
1089959150 11:122600221-122600243 ACCTGGGCATTTGGGGTCAATGG + Intergenic
1090558577 11:127903702-127903724 TCCAGGGGGTTGGGGGTCTGAGG - Intergenic
1096146791 12:49284055-49284077 AACAGGGGGTTGGGGGTGAGGGG + Intergenic
1099505318 12:83468743-83468765 ACCAGAGGGGTGGGGGTCAGTGG + Intergenic
1100915375 12:99414678-99414700 TCCAGGGGGTGAGGGGTTAGGGG + Intronic
1103904116 12:124318833-124318855 ACCATGGCGTGAGGGGGCAGGGG - Intergenic
1103904342 12:124319886-124319908 TCCAGGGAGATGGGGGTCAGGGG + Intergenic
1105744074 13:23360618-23360640 AGCAGGCAGTAAGGGGTCAGCGG - Intronic
1110551212 13:76813348-76813370 ACCAGGTCGCTAGGAGCCAGAGG - Intergenic
1111818242 13:93182042-93182064 CACAGGGCATTTGGGGTCAGAGG - Intergenic
1112381263 13:98892861-98892883 ACCACGGTTTTAGGGGGCAGGGG + Intronic
1112500891 13:99942270-99942292 ACCAGGGCTGTACGGGTGAGGGG - Intergenic
1114495265 14:23127560-23127582 ACCCTGGACTTAGGGGTCAGTGG - Intronic
1117511221 14:56453351-56453373 GCCTGGGCATTAGAGGTCAGAGG + Intergenic
1117587381 14:57224163-57224185 AACAGGGGGTTTGGGGTGAGGGG + Intronic
1122744950 14:103891965-103891987 ACCGGGGCGTTTGGGTCCAGAGG + Intergenic
1129066600 15:72909935-72909957 ACAAGGGGTTTAAGGGTCAGGGG - Intergenic
1131470355 15:92691253-92691275 ACCAGACCCTTAGGGGTCTGGGG + Intronic
1132361531 15:101220254-101220276 TCCAGTGGGTTAGAGGTCAGAGG - Intronic
1132753021 16:1467562-1467584 ACCTGGGAGGTGGGGGTCAGAGG - Intronic
1132946548 16:2534738-2534760 ACCAGGGCCTTGTGGGCCAGAGG + Intergenic
1133743987 16:8674031-8674053 AACAGGGCGCTGGGAGTCAGAGG - Intergenic
1135980439 16:27142918-27142940 CCCATGGGCTTAGGGGTCAGAGG - Intergenic
1137304329 16:47183470-47183492 GCCTGGGGGTCAGGGGTCAGGGG - Intronic
1138963349 16:62053550-62053572 ACCAGGGTGATGGGAGTCAGAGG + Intergenic
1139965702 16:70744291-70744313 GCCAGGGTGTGAGGGGTCTGTGG - Intronic
1140870825 16:79104935-79104957 AGCAGGTCGTTAGGGGTCAGGGG + Intronic
1142964048 17:3569891-3569913 GCCAAGGGGTTAGGGGCCAGGGG + Intronic
1143472379 17:7184029-7184051 ACCAGGGAGGTGGGGGACAGTGG + Intergenic
1144949906 17:18988558-18988580 ACCAGGAAGTGAGGGGCCAGGGG + Intronic
1145214989 17:21044095-21044117 ACCAGGGCGCCAAGGGTCTGGGG + Intergenic
1146094797 17:29918972-29918994 AACAGAGGGTTAGGGGTGAGTGG - Intronic
1146692712 17:34887781-34887803 ACCAGGGTGCTGGGGGACAGTGG - Intergenic
1147326033 17:39670054-39670076 ACCAGGGCGTCAGCAGGCAGGGG - Exonic
1148600870 17:48893248-48893270 AGGAGGGCATTAGAGGTCAGAGG - Intronic
1148684710 17:49495088-49495110 ACCAGGGCGGGATGGGTGAGAGG + Intergenic
1148778014 17:50106609-50106631 GCCAGGGCTGGAGGGGTCAGGGG + Intronic
1157076079 18:44469133-44469155 TCCAGGGAGTTAGAGGCCAGTGG - Intergenic
1161079968 19:2305754-2305776 ACCAGGGCGGTGGGAGTAAGGGG + Intronic
1161752841 19:6110273-6110295 ACCCGGACGTTTGGGGTGAGCGG + Intronic
1162213214 19:9109888-9109910 CCCAGGGCTTTAGGAGGCAGAGG - Intergenic
1162546783 19:11335601-11335623 CCGGGGGGGTTAGGGGTCAGAGG + Intronic
1165855320 19:38876506-38876528 TCCAGGGAGTCAGGGGTCAGAGG + Intronic
1167245280 19:48369373-48369395 CCCAGGGTTTTGGGGGTCAGTGG + Intronic
1168555857 19:57339303-57339325 ACCAAGGTGTTAGGGGACGGAGG + Intergenic
925943791 2:8842491-8842513 ACTAGGGGGTTTGGGGTGAGAGG - Intergenic
932122223 2:69112433-69112455 ACCTGGGCATTTGGAGTCAGTGG - Intronic
932326470 2:70865374-70865396 ACCAGGGGGTCAGGAGTCACTGG + Intergenic
937205663 2:120235513-120235535 GCCAGGGGGTTGGGGGTTAGGGG + Intergenic
941556541 2:166989155-166989177 GCTCGGGGGTTAGGGGTCAGGGG - Intronic
945598855 2:211832743-211832765 AACAGGGAGCGAGGGGTCAGAGG + Intronic
1171013896 20:21522981-21523003 ACCCGCGCGTTTGGGGGCAGGGG - Intergenic
1172271463 20:33657849-33657871 ACCAGGAGGCTGGGGGTCAGAGG + Exonic
1174216450 20:48920267-48920289 ACCTGGGCTTTGGGAGTCAGGGG - Intergenic
1180041797 21:45283902-45283924 ACCAGGGGGGTAGGGGACAGTGG - Intronic
1181170843 22:21009011-21009033 ACCAGGGCGTAGGTGGCCAGGGG + Intergenic
953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG + Intronic
954461799 3:50630994-50631016 GCCTGGACGTTTGGGGTCAGTGG + Intronic
958993899 3:100879167-100879189 ACCAGGGGGTGAGGGGCAAGGGG - Intronic
961057194 3:123799184-123799206 ATCAGGGGGTGAGGGGTGAGGGG - Intronic
962082263 3:132152556-132152578 ATCAGGGCATTTGGAGTCAGGGG + Intronic
969977769 4:11122009-11122031 GTCAGGGGGTTAGGGGTTAGGGG - Intergenic
973863214 4:55086169-55086191 AACATGGACTTAGGGGTCAGAGG + Intronic
974298015 4:60029196-60029218 TCAAGGGCCTGAGGGGTCAGGGG - Intergenic
975858845 4:78654682-78654704 TCCTGGGGGTCAGGGGTCAGGGG - Intergenic
978605060 4:110470928-110470950 AGCAGGGGGTTGGGGGGCAGGGG + Intronic
983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG + Intergenic
994334395 5:98547369-98547391 GCTCGGGGGTTAGGGGTCAGGGG - Intergenic
997408070 5:133668274-133668296 AACAGAGCTTCAGGGGTCAGGGG + Intergenic
998824969 5:146091955-146091977 ACCAGGCCTTTAGGTGTAAGAGG - Intronic
1000906555 5:166972093-166972115 GCTCGGGGGTTAGGGGTCAGGGG + Intergenic
1004080095 6:12383583-12383605 CCCTGGGAGTTAGGGCTCAGTGG + Intergenic
1004553145 6:16669328-16669350 ATCAGGGTGTTAGGTTTCAGAGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1015786214 6:136923072-136923094 GCCAGGACATTAGGGGGCAGGGG - Intronic
1017481175 6:154857632-154857654 ACCAGTGGCTTAGGGGTGAGGGG + Intronic
1022553746 7:31270509-31270531 GCCGGGGCGTTGGGGGTTAGGGG - Intergenic
1023619746 7:42057879-42057901 AGCAGGGGGCGAGGGGTCAGCGG + Intronic
1024005677 7:45223815-45223837 GCCAGGGTATCAGGGGTCAGCGG + Intergenic
1029780937 7:102731767-102731789 ACCAGGGAGTTTGGGGTGGGTGG - Intergenic
1030618834 7:111767765-111767787 AATTGGGCCTTAGGGGTCAGTGG - Intronic
1034436725 7:151066098-151066120 GCCAGGGGGTGAGGGGGCAGGGG + Intronic
1035784595 8:2250756-2250778 ACCCCGGCGTCAGGTGTCAGGGG + Intergenic
1035808212 8:2470957-2470979 ACCCCGGCGTCAGGTGTCAGGGG - Intergenic
1036985658 8:13526768-13526790 GCCAGGGGGTTGGGGGACAGGGG + Intergenic
1040856894 8:51957975-51957997 ACAAAGGAGATAGGGGTCAGGGG - Intergenic
1047255284 8:123209250-123209272 CACAGGCCGTCAGGGGTCAGAGG - Exonic
1049357220 8:142194947-142194969 TCCAGCCCGTCAGGGGTCAGAGG + Intergenic
1049403402 8:142440879-142440901 ACCAGGGCTTCAGCGGTCACTGG - Intergenic
1055464402 9:76550043-76550065 CCCACGGCGTGGGGGGTCAGTGG - Intergenic
1056085693 9:83147604-83147626 ACCAGGGCTTTAGGAGTCGCAGG - Intergenic
1057493642 9:95542680-95542702 AACAGGGGGCTAGGGTTCAGTGG + Intergenic
1062042035 9:134408635-134408657 CTCAGGCCGTTGGGGGTCAGTGG - Intronic
1062274862 9:135725924-135725946 ACCTGGGCGATAGGGGTCTGGGG + Intronic
1189396161 X:40624729-40624751 AGCTGGGGGTGAGGGGTCAGTGG + Intergenic
1190421657 X:50290734-50290756 CCCATGGGGTTAGGGGGCAGGGG + Intronic
1192553826 X:72074363-72074385 CCCAGGGGGATAGGGGTCAATGG - Intergenic
1193235843 X:79106302-79106324 GTCAGGGGGTTAGGGGTAAGTGG + Intergenic
1194490770 X:94546074-94546096 GCCAGGGTGTTAGGGGAAAGAGG + Intergenic
1200074281 X:153543546-153543568 GCCAGGGAGGTGGGGGTCAGAGG + Intronic