ID: 953390487

View in Genome Browser
Species Human (GRCh38)
Location 3:42531068-42531090
Sequence TTGAGGACTTTCTTGACCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390487_953390496 25 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153
953390487_953390490 7 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390490 3:42531098-42531120 GATCCCAGGACAAGTCCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 104
953390487_953390495 24 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390487_953390488 -7 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390488 3:42531084-42531106 TCCTCAAAATGTCTGATCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390487 Original CRISPR TTGAGGACTTTCTTGACCCT TGG (reversed) Intronic