ID: 953390489

View in Genome Browser
Species Human (GRCh38)
Location 3:42531085-42531107
Sequence TCCTGGGATCAGACATTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390489_953390495 7 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390489_953390497 19 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390497 3:42531127-42531149 CTGCACCTAGGGCTGACCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 188
953390489_953390498 20 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390498 3:42531128-42531150 TGCACCTAGGGCTGACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 98
953390489_953390490 -10 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390490 3:42531098-42531120 GATCCCAGGACAAGTCCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 104
953390489_953390496 8 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390489 Original CRISPR TCCTGGGATCAGACATTTTG AGG (reversed) Intronic