ID: 953390491

View in Genome Browser
Species Human (GRCh38)
Location 3:42531101-42531123
Sequence CAACCTGAGGGACTTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390491_953390496 -8 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153
953390491_953390495 -9 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390491_953390498 4 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390498 3:42531128-42531150 TGCACCTAGGGCTGACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 98
953390491_953390497 3 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390497 3:42531127-42531149 CTGCACCTAGGGCTGACCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390491 Original CRISPR CAACCTGAGGGACTTGTCCT GGG (reversed) Intronic