ID: 953390492

View in Genome Browser
Species Human (GRCh38)
Location 3:42531102-42531124
Sequence GCAACCTGAGGGACTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390492_953390497 2 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390497 3:42531127-42531149 CTGCACCTAGGGCTGACCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 188
953390492_953390498 3 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390498 3:42531128-42531150 TGCACCTAGGGCTGACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 98
953390492_953390495 -10 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390492_953390496 -9 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390492 Original CRISPR GCAACCTGAGGGACTTGTCC TGG (reversed) Intronic