ID: 953390495

View in Genome Browser
Species Human (GRCh38)
Location 3:42531115-42531137
Sequence CTCAGGTTGCAGCTGCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390487_953390495 24 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390489_953390495 7 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390492_953390495 -10 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232
953390491_953390495 -9 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390495 3:42531115-42531137 CTCAGGTTGCAGCTGCACCTAGG 0: 1
1: 0
2: 2
3: 29
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390495 Original CRISPR CTCAGGTTGCAGCTGCACCT AGG Intronic