ID: 953390496

View in Genome Browser
Species Human (GRCh38)
Location 3:42531116-42531138
Sequence TCAGGTTGCAGCTGCACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953390489_953390496 8 Left 953390489 3:42531085-42531107 CCTCAAAATGTCTGATCCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 206
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153
953390491_953390496 -8 Left 953390491 3:42531101-42531123 CCCAGGACAAGTCCCTCAGGTTG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153
953390487_953390496 25 Left 953390487 3:42531068-42531090 CCAAGGGTCAAGAAAGTCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153
953390492_953390496 -9 Left 953390492 3:42531102-42531124 CCAGGACAAGTCCCTCAGGTTGC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 953390496 3:42531116-42531138 TCAGGTTGCAGCTGCACCTAGGG 0: 1
1: 0
2: 4
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953390496 Original CRISPR TCAGGTTGCAGCTGCACCTA GGG Intronic