ID: 953394022

View in Genome Browser
Species Human (GRCh38)
Location 3:42552403-42552425
Sequence CTGGAGTAGGTGAATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953394022 Original CRISPR CTGGAGTAGGTGAATGAACA TGG (reversed) Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
904290005 1:29478690-29478712 ATGGAGCAGGTGAACGCACAGGG + Intergenic
905914682 1:41676421-41676443 CAGGAGAAGGTGGAAGAACAGGG + Intronic
906638296 1:47425135-47425157 CTGGAATTGGTGAGTGACCAAGG - Intergenic
910654697 1:89608038-89608060 CTGATGCAGCTGAATGAACACGG + Intergenic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911512419 1:98824075-98824097 CTGGGGCAGGAGAATGAACCTGG - Intergenic
912387305 1:109277974-109277996 CTGAAGTAGGTGAATGTGCCAGG + Intergenic
912392106 1:109310531-109310553 CTGAAGCAGGAAAATGAACATGG - Exonic
912695581 1:111839497-111839519 CTGAAGCAGGAAAATGAACAAGG - Intronic
912700239 1:111872872-111872894 CTGGAGTTGTTGAATGAATGAGG - Intronic
912801771 1:112723870-112723892 CTGGAGTAGGGGAAAGACAAGGG + Intronic
918357787 1:183722132-183722154 CTGGAGAAGGTAAGAGAACAGGG + Intronic
918619794 1:186590106-186590128 CTGGCACATGTGAATGAACATGG + Intergenic
920159630 1:203986427-203986449 CTGGACTGGGTGAATGAGAATGG + Intergenic
922510106 1:226158625-226158647 TTGGTTTAGGTGAAAGAACATGG - Intronic
923126440 1:231038953-231038975 CTGGACGAGGTGAATGGAAAGGG + Intronic
923345860 1:233052072-233052094 TTGGAGAAGGTTATTGAACAGGG - Intronic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1066609320 10:37222259-37222281 CTGGGGAAGGTGAAGAAACATGG - Intronic
1069395504 10:67983477-67983499 CATCAGTAGGTGAATGAATAAGG + Intronic
1069733498 10:70634880-70634902 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
1070424682 10:76273779-76273801 CTGGATCAGGTGAATGAAAAGGG + Intronic
1073675899 10:105646756-105646778 CTGGAGGAGGTGACTGAAGGTGG + Intergenic
1074709151 10:116162552-116162574 CTGGAGCATGTGAGTGCACAGGG + Intronic
1077937510 11:6803025-6803047 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
1078042949 11:7884881-7884903 GTGGAGCAGGTAAATGATCAAGG + Intergenic
1080392306 11:31859789-31859811 CTGGAGATAGTGAATCAACATGG - Intronic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1081151480 11:39638436-39638458 ATGGAATAGGTGAATAGACATGG + Intergenic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1084911368 11:72392099-72392121 CTGGAGTTGGTGAAGCAAGAAGG + Intronic
1085206558 11:74736870-74736892 GTGGAGGAGGTGAGAGAACAAGG - Intergenic
1087016280 11:93557354-93557376 CTGGGGAATGTGAATGACCATGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089227054 11:116933496-116933518 CTTCAGTAGGTGAATGGATAAGG - Intronic
1089724797 11:120466649-120466671 TTGGCATAAGTGAATGAACAAGG - Intronic
1090815954 11:130295809-130295831 CTCTAGTAGGTGAGAGAACAAGG - Intronic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1093078858 12:14786796-14786818 CTGGAGGAGGGGAAGAAACAGGG + Exonic
1093907993 12:24714481-24714503 CTGGAGTAAGGAAATGAACAAGG - Intergenic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1095149047 12:38769131-38769153 TTGGAATAGGGTAATGAACAAGG + Intronic
1095301699 12:40591701-40591723 CTGGAGTAGATGAATACACTAGG + Intergenic
1095975710 12:47939599-47939621 CTGGACTAGGTGAGTGAGGAGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1099068350 12:78012698-78012720 CTGGAGTAGGTGGTTGGAGATGG - Intronic
1099800940 12:87455606-87455628 CTGGAGGGGGTATATGAACAGGG + Intergenic
1100369636 12:93956018-93956040 CTTGTGTAGGTGAGAGAACATGG + Intergenic
1102734209 12:115143731-115143753 CTGAAGGAAGTGAATGAACTAGG + Intergenic
1104097110 12:125567914-125567936 CTGGGATGTGTGAATGAACAGGG + Intronic
1107044197 13:35977791-35977813 CTGGAGTTAGTGCTTGAACATGG - Intronic
1108215427 13:48179139-48179161 TTAGAGTAGGTGAATGGAGAGGG + Intergenic
1108446270 13:50511957-50511979 CTGGAGTAGGTGAGTGCATTTGG + Intronic
1109858551 13:68166840-68166862 CTGGAATAGGTACATGAAGAAGG + Intergenic
1110756422 13:79179865-79179887 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1112538885 13:100286489-100286511 GTGGAGTAGGTAACTGAAAAAGG + Intronic
1112575793 13:100635481-100635503 GAGGAGTAGGTGAATTAATAAGG - Intronic
1113529373 13:111010027-111010049 CTGCAGTCGGTGACTGTACACGG - Intergenic
1115161641 14:30403110-30403132 TTGGAGGAGGTGAATAATCAGGG - Intergenic
1117595018 14:57318627-57318649 CTTGGCTAGGAGAATGAACATGG - Intergenic
1118035052 14:61857548-61857570 CTGGAGTTGGTTAAGGAAGAGGG + Intergenic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1121118224 14:91358393-91358415 CTGGAGTAGGTGAGGGGTCAAGG - Intronic
1121570274 14:94941895-94941917 TTGGAGCAGGTGAATGACTAAGG - Intergenic
1124683159 15:31754902-31754924 CTGGAGTAGGGGTATGAAGGAGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127691631 15:61402822-61402844 CTTGAGTAGAGGAAGGAACAGGG + Intergenic
1133061424 16:3177274-3177296 GTGGAGTAGGTAATTGAAAAAGG - Intergenic
1133563597 16:6971942-6971964 CGGGAGAATGTGAATGAGCATGG + Intronic
1134090684 16:11390265-11390287 CTGGAGCTGGTGAGTGAGCAAGG - Exonic
1135167808 16:20156216-20156238 CTGGAGCAGGTGGCTGCACAAGG - Intergenic
1137566301 16:49534684-49534706 CTGGGGTAGGGGCATGGACATGG - Intronic
1138053749 16:53811093-53811115 CAAGAGTAGGTGCATGAACTAGG - Intronic
1138296578 16:55890964-55890986 GTGGAGCAGGTGATTGAAAAAGG - Intronic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1141067715 16:80927411-80927433 TTGGAGGAGGTGAATGAAGGAGG + Intergenic
1141139686 16:81489299-81489321 CTGGAGTTGGTGGGTGAAGAGGG + Intronic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1141671246 16:85492869-85492891 CTGGAGCAGGTGACAGAGCAGGG + Intergenic
1144388098 17:14768950-14768972 GGGGAGTAGGGGAATGAAAAAGG + Intergenic
1145348484 17:22057039-22057061 CTGGAGTACATGTGTGAACATGG + Intergenic
1147459854 17:40561280-40561302 TTGGAGGAGGTGGATGAGCAAGG + Intronic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148339841 17:46866856-46866878 TGGGAGTAGGTGGAAGAACAGGG + Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1149251388 17:54774009-54774031 CTGCAGTAGATGAAAGATCAGGG - Intergenic
1150734942 17:67728726-67728748 CTTGGGTAGGTGAATAAACAAGG - Intronic
1152527855 17:80899698-80899720 CGCGTGTAGGTGAATGAACTTGG + Intronic
1152611668 17:81317911-81317933 CAGGAGTATGTAAATGGACAGGG - Intronic
1154110875 18:11567484-11567506 CTGGAGGAGGTGGAGGAAGAGGG + Intergenic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1159097767 18:63923873-63923895 ATTGAATAGTTGAATGAACACGG - Intronic
1164915216 19:32046627-32046649 CTGGAGGAGGTGAACCAAGAGGG - Intergenic
1165154636 19:33779530-33779552 CTGGAGAGGGAGAATGGACATGG - Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1166565332 19:43761765-43761787 CTGGAGCAGGGGAATTGACAGGG - Intergenic
1167584447 19:50365686-50365708 CTGGAGGTGGGGCATGAACAGGG - Exonic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
926381413 2:12294229-12294251 CTGGAATAAATGAATGAACATGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
928623795 2:33118645-33118667 CTGGTGAATGTGGATGAACAGGG + Intronic
929560106 2:42951165-42951187 CTGGAGTTGGAGAAGGCACAGGG + Intergenic
930461891 2:51691748-51691770 CTGGAGAAGTAGTATGAACAAGG + Intergenic
931425767 2:62169685-62169707 GTGGAGTAGGTAATTGAAAAAGG - Intergenic
932139164 2:69260465-69260487 GTGGGGAAGGTGTATGAACAGGG - Intergenic
936677142 2:114728487-114728509 CAGGAGTAGGTACATGAACCAGG + Intronic
937019687 2:118639071-118639093 CTGGATTGGGTGAGTGAATATGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938188390 2:129253509-129253531 CTGGAGGAGGTGGATGAATGAGG + Intergenic
938679036 2:133670594-133670616 CTGGTGTAGGGTGATGAACAAGG + Intergenic
939488501 2:142847682-142847704 CTGAAGTAGGTGGATGAATGGGG + Intergenic
939742367 2:145924837-145924859 CTGGAGTGGTGGCATGAACATGG + Intergenic
940133704 2:150412578-150412600 CTGGAGTAGTTGAAAGGACATGG - Intergenic
941876072 2:170434648-170434670 GTGGAGTAGGTAATTGAAAAAGG + Intronic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942914448 2:181286369-181286391 CTTGTTTAGTTGAATGAACATGG + Intergenic
943321669 2:186451696-186451718 CAGAAGTTGGTGAATGAACATGG - Intergenic
943896192 2:193363743-193363765 CAGGAGTAGATGAATAAACCAGG - Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
945320401 2:208415384-208415406 CGGTAGTAGGTGAATGAATGTGG - Intronic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
1169809608 20:9596224-9596246 CTGGAGCAGGTCAATCAACTAGG + Intronic
1171236452 20:23529311-23529333 GTGGAGCAGGTGATTGAAAAAGG + Intergenic
1172011215 20:31846927-31846949 ATGGAGTAGGGATATGAACATGG + Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
949752250 3:7367575-7367597 CTGCTGTAGGAGAATAAACATGG + Intronic
951918618 3:27828765-27828787 GTGGAGCAGGTGATTGAAAAAGG - Intergenic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
954481022 3:50801457-50801479 GTGGAGCAGGTGATTGAAAAAGG + Intronic
956374560 3:68600565-68600587 CTGGACTAAAGGAATGAACAGGG + Intergenic
956554331 3:70501280-70501302 AGGGAGAAGGTGAAAGAACAAGG + Intergenic
957822220 3:85391824-85391846 TTGGATTAGCTGAATCAACACGG + Intronic
959175506 3:102904525-102904547 GTGGAGTAGGTAACTGAAAAAGG + Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960040728 3:113147938-113147960 ATGGAAAAGGTGAATAAACAGGG - Intergenic
961581955 3:127890674-127890696 GTGGAGCAGGTGATTGAAAAAGG - Intergenic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
963654094 3:148023814-148023836 CTAGAGTGGTTGAATGAAGAAGG + Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
969141275 4:5076004-5076026 CTGGAGATGCTGAATTAACATGG + Intronic
969576399 4:8038523-8038545 CTGGAGTAGGGGGCTGAACCTGG - Intronic
970776729 4:19683320-19683342 CTTGAGTGGGTCCATGAACAGGG - Intergenic
971066809 4:23042353-23042375 GTGGAGTAGGTAACTGAAAAAGG - Intergenic
972000501 4:34025962-34025984 CTGGTGTAGGGAAATGAATAGGG - Intergenic
972102548 4:35440534-35440556 CTGGAGTGTGAGAATTAACAAGG - Intergenic
975204956 4:71634737-71634759 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
975430365 4:74282917-74282939 CTGGCCTAAGTGATTGAACATGG - Intronic
976230700 4:82840029-82840051 CTGGTATAGAAGAATGAACATGG + Intronic
977769516 4:100841089-100841111 CAGGCTTAGGTGAATGCACAGGG - Intronic
978979708 4:114928492-114928514 TTGGAGTAAGTGAAAGAAAATGG - Intronic
979011117 4:115370285-115370307 CTGCAGTAGGTAACTGTACATGG + Intergenic
979770732 4:124521782-124521804 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG + Intronic
987589578 5:19906682-19906704 TTTGAATAGGTGAATGAGCAGGG - Intronic
988194873 5:27992152-27992174 CTGGAGTAGGAGAAGGAATTAGG - Intergenic
988396642 5:30704399-30704421 GGGGAGTAGGTGTATGAACAGGG + Intergenic
991698833 5:69298522-69298544 CAGGAGTAGGAAAATGAAAAGGG - Intronic
993055643 5:82976162-82976184 GTGGAGCAGGTGATTGAAAAAGG + Intergenic
995129016 5:108609989-108610011 GTGGAGTAGGTGATCGAAAAAGG + Intergenic
995815158 5:116158970-116158992 CTGGACTACATTAATGAACATGG - Intronic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
1000237919 5:159379963-159379985 AGGGAGGAGGTGTATGAACAGGG + Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1004314564 6:14574659-14574681 CAGGAGTAGGGGATTCAACAGGG - Intergenic
1004381913 6:15139800-15139822 CTGAAGTAGGTGGATGAAGTAGG - Intergenic
1005360246 6:25024399-25024421 CTCGTGTGGGTGAAGGAACAAGG - Intronic
1006055740 6:31383341-31383363 CTGGGGAAGGTGAATCACCAGGG + Intergenic
1006299956 6:33188565-33188587 CTGAAGTAGGGGAGTCAACATGG + Intronic
1006904376 6:37523189-37523211 CTGGACTAGGTGAGTTTACAGGG - Intergenic
1007310163 6:40939117-40939139 CTGGGGTGGGTAAATGGACATGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011556703 6:88576831-88576853 GAGGAGCAGGTGAATGAAGAAGG + Intergenic
1011992011 6:93533393-93533415 ATGAATTAGGAGAATGAACATGG - Intergenic
1012681559 6:102188982-102189004 CTGGAGTAGGGCAACGACCAGGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1017177942 6:151522416-151522438 GTGGAGTAGGTCATTGAAAAAGG - Intronic
1019312873 7:371250-371272 CTGGGGCAGGTGACTGCACAGGG + Intergenic
1020175438 7:5878311-5878333 CTGGACTAGGTGGGGGAACAGGG + Intergenic
1020907805 7:14086669-14086691 CTGGAGTATGTGAACCAAAATGG - Intergenic
1021056409 7:16052632-16052654 CTGGAGTAGATTAGTGAAAAAGG - Intergenic
1023626570 7:42120732-42120754 TTGGAATTGGTGCATGAACATGG + Intronic
1024305606 7:47926835-47926857 CTAGAGAAGATGAGTGAACAAGG + Intronic
1027879489 7:83815580-83815602 CTGGTATAGGTGAGTGAAAATGG + Intergenic
1028833137 7:95346991-95347013 TTGGAGTTGGAGAATGAAAAAGG + Intergenic
1029995416 7:105003217-105003239 CTGTAGTAGGTGAGTGTACTGGG + Intergenic
1030492895 7:110260809-110260831 CTTCAACAGGTGAATGAACAAGG + Intergenic
1030541223 7:110832769-110832791 CTGGAGTATGAGAATGCAGAGGG + Intronic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1031541151 7:122996039-122996061 ATGCAGGACGTGAATGAACAGGG - Intergenic
1031556013 7:123177333-123177355 CTGCAGTAGGTGAGAGACCATGG - Intronic
1032080460 7:128856103-128856125 CTGGAGAAGGTGGACCAACAGGG - Intronic
1034720235 7:153285426-153285448 CTGGGGTAGGGGGAGGAACAGGG + Intergenic
1038789017 8:30650665-30650687 CTGGAGTACGGGCATGATCATGG - Intronic
1038884838 8:31651818-31651840 CTGCAGTAGGTGAATCCACCAGG - Intronic
1039008642 8:33069091-33069113 GTGGACGAGGTGAAAGAACAGGG - Intergenic
1042817532 8:72894099-72894121 TTGGGGTAGGTGAATGATGAAGG + Intronic
1043281378 8:78471045-78471067 GGGGAGTGGGTGTATGAACAGGG - Intergenic
1046823363 8:118659885-118659907 CAGGAGTAGAGGAATGACCAAGG + Intergenic
1047297618 8:123585243-123585265 CTGGAGTAGCAGATTTAACACGG + Intergenic
1047643129 8:126842039-126842061 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
1048544173 8:135370703-135370725 ATGGAGTAAGTGAACCAACATGG + Intergenic
1048897135 8:139002080-139002102 CTGCAACAGGTGAATGCACAGGG - Intergenic
1051599151 9:18854742-18854764 CTGGAGAGGGTGGAAGAACATGG + Intronic
1055740226 9:79380222-79380244 CTGGTGTAGGGGAGTAAACAAGG - Intergenic
1056063270 9:82906944-82906966 CTGGAGTGGGGGAATGTAAAGGG + Intergenic
1057680499 9:97177417-97177439 CTGGAGTAGGTGGAGAGACATGG + Intergenic
1058079099 9:100682879-100682901 CTGGAATAACTGAATAAACATGG + Intergenic
1058385648 9:104431920-104431942 CTGGAGTGAGTCAATGACCATGG - Intergenic
1058434329 9:104948323-104948345 CTTGAGTAGCTGAATGACCGTGG + Intergenic
1060438268 9:123615047-123615069 CTGGAGAATGCGAATGATCATGG + Intronic
1060603554 9:124894692-124894714 CTGGGGTAACTGAATGAATAGGG - Intronic
1061123462 9:128658772-128658794 CTGGAGTAGTGGTATGATCATGG + Intergenic
1062083874 9:134638598-134638620 ATGGAGGAGGTGGAGGAACAAGG - Intergenic
1186511307 X:10131937-10131959 CTGGAGTAGTCGAATTCACAGGG + Intronic
1187107935 X:16263627-16263649 CTGGAAGAGGTCAATGAAGATGG + Intergenic
1189348458 X:40260070-40260092 CTGGAACTGGTGAGTGAACAGGG - Intergenic
1189833630 X:44999512-44999534 GTAGAGTAGGTGATTGAATAAGG + Intronic
1193010457 X:76669709-76669731 CTGGAATATATGAATGAGCATGG + Intergenic
1195846643 X:109236316-109236338 GTGGAGTAGGTAATTGAAAAAGG + Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1197268772 X:124403767-124403789 GTGGAGTAGGTAATTGAAAAAGG - Intronic
1197278083 X:124503194-124503216 CAAGAGTAGGTGAAGGAACTTGG + Intronic
1198117116 X:133555007-133555029 CTGGAGTAGCTGTATCTACAGGG + Intronic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199741672 X:150741458-150741480 ATGGGGTAGGGGAAGGAACAGGG - Intronic
1200341240 X:155398597-155398619 CTGGAGTAGGGGAGTGGACAGGG + Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic