ID: 953395306

View in Genome Browser
Species Human (GRCh38)
Location 3:42564651-42564673
Sequence CAGGGTAACTCACCTCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953395306_953395315 29 Left 953395306 3:42564651-42564673 CCAAGTAGAGGTGAGTTACCCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 953395315 3:42564703-42564725 ATCACCATTCCATTAGGTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 80
953395306_953395313 23 Left 953395306 3:42564651-42564673 CCAAGTAGAGGTGAGTTACCCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 953395313 3:42564697-42564719 TCACCTATCACCATTCCATTAGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953395306 Original CRISPR CAGGGTAACTCACCTCTACT TGG (reversed) Intronic
902873262 1:19326652-19326674 CAGGCCAGCTCTCCTCTACTCGG - Intronic
902876792 1:19345174-19345196 CCAGGTCACTCACCTCTACCAGG + Exonic
905464245 1:38140676-38140698 CAGGGTCACTCACTTCCACTGGG + Intergenic
923160614 1:231311550-231311572 CATGGTAAATCACTTCTAGTTGG + Intergenic
924309256 1:242722794-242722816 CATGGTAACTCACCTTTTATAGG - Intergenic
1063633891 10:7762312-7762334 CAGCGTAACTCATCTCTGTTTGG - Intronic
1065577237 10:27133888-27133910 CTGGGAAACTAACCACTACTAGG + Intronic
1071595762 10:86922831-86922853 GAGGGTAACTCACCACTCCTGGG - Intronic
1072459621 10:95607072-95607094 CAGGGTGACTCAGCTCTTCTGGG - Intronic
1073626909 10:105107646-105107668 CAGGGGACCTCACATATACTTGG - Intronic
1078068565 11:8093874-8093896 CAGGCCCACTCATCTCTACTAGG - Intronic
1081634862 11:44714374-44714396 CAGGGGAGTTCACTTCTACTGGG - Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1089674390 11:120080223-120080245 CAGACTATCTCAACTCTACTGGG - Intergenic
1094525022 12:31225726-31225748 CAGGGCACCCCAACTCTACTGGG + Intergenic
1100870319 12:98903975-98903997 CAGGGTCTCTGGCCTCTACTGGG - Intronic
1104372475 12:128235886-128235908 CAGGGAAAGGCAGCTCTACTGGG + Intergenic
1126147383 15:45488636-45488658 CAGGGTAACTTATCTGTATTTGG - Intronic
1129647978 15:77455561-77455583 CTGGATAAGTCCCCTCTACTAGG + Intronic
1130968157 15:88712203-88712225 CAGGGCTACTCACCTCTGATGGG - Intergenic
1132203212 15:99969261-99969283 GAGGGCAGCTCACCTCTGCTGGG - Intergenic
1133335855 16:5006368-5006390 CAGGTTAACTCACTGCTGCTTGG - Intronic
1135066259 16:19312738-19312760 CAGGGTCATTCACCTCTTCCTGG + Intronic
1138410471 16:56835636-56835658 CAGGGCAAGTCACCTCAACCTGG + Intronic
1145858615 17:28187209-28187231 CCATGTAACTCACCTCTACCAGG + Intronic
1160421541 18:78750797-78750819 CAAGGTAACTGAGCTCTGCTGGG + Intergenic
1168424063 19:56224534-56224556 CGGGCAAACTCTCCTCTACTTGG + Intronic
927309568 2:21615121-21615143 CAGAGAAAATCACCTATACTAGG - Intergenic
928790422 2:34944873-34944895 AAGGTTAACTCAAATCTACTGGG - Intergenic
929121011 2:38484184-38484206 CAGGCTCCCTCACCTCAACTGGG + Intergenic
947696128 2:232190923-232190945 CAGGGTAACTCACCCTTGTTTGG - Intronic
1169187322 20:3629648-3629670 CAGGCTACCTCACTGCTACTGGG + Intronic
1173664062 20:44752906-44752928 CAGGGAGACTCAGCTCTCCTTGG - Intronic
1179291188 21:40019696-40019718 CATGGGTACTCACCTCCACTGGG + Intronic
950014360 3:9745387-9745409 CAGGCTAACCCACCTCTGTTAGG + Intronic
952578501 3:34803424-34803446 GAGGGTTTCTCACCTCTAGTGGG + Intergenic
953395306 3:42564651-42564673 CAGGGTAACTCACCTCTACTTGG - Intronic
959187998 3:103071562-103071584 CAGGGTCAGTGACCTCTAATAGG + Intergenic
962092535 3:132260042-132260064 CTGGGTAACTCATCTCTTATTGG + Intronic
964262930 3:154860525-154860547 CAGGGTAACACACATATAGTAGG - Intergenic
964318403 3:155468295-155468317 CAGAGAAAATCACCTTTACTAGG + Intronic
970718588 4:18958668-18958690 CAGAGCAACTCACCTCATCTAGG + Intergenic
973336255 4:48959433-48959455 CAGCCAAACTCACCTCTTCTAGG - Intergenic
978068542 4:104437086-104437108 CAGGTTAAATAACCTGTACTGGG - Intergenic
980174909 4:129332951-129332973 CAGAGTCTCTCACCACTACTAGG + Intergenic
981932690 4:150208093-150208115 CAGGGAAAATCCCCTGTACTTGG - Intronic
982151172 4:152459077-152459099 CAGGGCTCCTCACCTCTCCTAGG - Intronic
984185766 4:176541354-176541376 CAAGGTAATTCACATTTACTTGG + Intergenic
998994041 5:147851209-147851231 CAAGGTAGCTCATCTCTGCTAGG + Intergenic
999380167 5:151115860-151115882 CAGGGGACCTTAACTCTACTGGG + Intronic
1006029620 6:31169903-31169925 CAGGGTCTCTCACATCTCCTAGG - Intronic
1008050823 6:46898994-46899016 CAGGTGAGCTCTCCTCTACTGGG + Intronic
1013151846 6:107453761-107453783 CAGGCTACCATACCTCTACTAGG - Intronic
1015173001 6:130275455-130275477 CAGTGTAATTCAGCCCTACTGGG - Intronic
1016893767 6:149032683-149032705 CAGGGAAATTCATCTCTTCTGGG + Intronic
1017142095 6:151200406-151200428 CAGAGTTTCTCACCTATACTAGG - Intergenic
1025240310 7:57266384-57266406 CAGGGTAGCTCACTTCTAGGTGG - Intergenic
1029411360 7:100413566-100413588 CAGGAGCACTCACCTCTCCTTGG + Intronic
1032558010 7:132857930-132857952 CAGGATAACTCCCGTCTTCTGGG + Intronic
1032727761 7:134606845-134606867 CAGGGACACTCACCTCTAAGTGG - Intergenic
1045227494 8:100263823-100263845 CTGGGTATCTGACCTCTAATTGG - Intronic
1048624567 8:136171368-136171390 CAGTGTTACTCTCATCTACTTGG + Intergenic
1049849545 8:144823445-144823467 CACGCTCACTCACCTCTGCTAGG + Intergenic
1061813429 9:133177575-133177597 GAGGGTTTCTCACCTCTAGTGGG - Intergenic
1061931651 9:133835998-133836020 CAGGGACACACACCTCAACTGGG - Intronic
1189705653 X:43756340-43756362 CCGGGTGACTCTCCTCTCCTTGG + Intergenic
1197159518 X:123307904-123307926 CAGGGAAAATCAACACTACTGGG - Intronic
1199187958 X:144939139-144939161 GAGGGTAGCTCCTCTCTACTAGG + Intergenic
1201799627 Y:17940965-17940987 CATGGTAACTCAGCCATACTTGG + Intergenic
1201801926 Y:17964991-17965013 CATGGTAACTCAGCCATACTTGG - Intergenic