ID: 953396084

View in Genome Browser
Species Human (GRCh38)
Location 3:42571466-42571488
Sequence GTGTATGTGAATGTACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953396084 Original CRISPR GTGTATGTGAATGTACAGGA TGG Intronic
900272095 1:1796181-1796203 GTGTCTGTGCATGTTCAGGTTGG + Intronic
902463934 1:16603009-16603031 GTGTCTGGGAATGTAATGGATGG - Intronic
902673764 1:17994148-17994170 GTGTTTGTGAATGTACAATGAGG - Intergenic
902729289 1:18358057-18358079 GTGTGTGTGAATGTTTAGGGGGG + Intronic
903072520 1:20733380-20733402 TTGTATGTGACAGTACAGCAAGG + Intergenic
903157163 1:21453666-21453688 GTGTCTGGGAATGTAATGGATGG + Intronic
903915160 1:26758449-26758471 CTGTATGTGTGTGTACAGGCAGG - Intronic
904210647 1:28884917-28884939 GTGTATGTGTATGTGTAGGGGGG - Intergenic
904554583 1:31351065-31351087 GTGTGTGTGTATGTTTAGGAAGG - Intronic
905862262 1:41359683-41359705 GTGTATGTGTATGGATCGGAGGG + Intergenic
906048314 1:42850273-42850295 GTGTTTGAGAATGTAGTGGAGGG + Intronic
906526420 1:46495887-46495909 GTGGGTGGGAGTGTACAGGAGGG + Intergenic
907244137 1:53096913-53096935 GTGTATGTGAGTGTACTGAGGGG - Intronic
907847212 1:58219690-58219712 GTGCAGGTGCATGTACAGGGAGG - Intronic
908800128 1:67871513-67871535 GTGTGTGTGAAGGAAAAGGAAGG - Intergenic
909957688 1:81800698-81800720 GTGCATGTGTGTGGACAGGATGG + Intronic
911202530 1:95060107-95060129 TTGTGTGTGTATGTATAGGAGGG - Intronic
911282954 1:95954130-95954152 GTGTGTGTGTGTGGACAGGAAGG + Intergenic
911396562 1:97317462-97317484 GTGTATGTAAATGTATAATAAGG + Intronic
913031563 1:114909487-114909509 GTGTGTGTGTGTGTACAGCAAGG - Intronic
913992459 1:143627419-143627441 GTGTCTGGGAATGTAATGGATGG - Intergenic
917709523 1:177670423-177670445 GTGTATGTGGATTCCCAGGAGGG + Intergenic
919095787 1:193034104-193034126 GTTTAAGTCAATTTACAGGAAGG + Intronic
920851214 1:209629215-209629237 GTGTTTGTGAATGTAATGGGAGG - Intronic
921188506 1:212690053-212690075 GTGTATGTGAATGTGAATGTGGG - Intronic
921582095 1:216906980-216907002 GTGTATGTGAGTGTATATGGTGG + Intronic
922222081 1:223616322-223616344 GTGTGTGTGGATGTGTAGGAAGG - Intronic
922786625 1:228286107-228286129 GAGGATGTGGATGTGCAGGAGGG + Exonic
923022191 1:230173809-230173831 ATGTATGTAAATGTATGGGAGGG + Intronic
923678648 1:236101273-236101295 GTGTGTGTGAATGTGGAGGTGGG + Intergenic
923694908 1:236238742-236238764 GTGTATGTGTGTGTACATGTAGG + Intronic
924458367 1:244236482-244236504 GTGCATGTGAGTGCAGAGGAGGG - Intergenic
1064301307 10:14125412-14125434 GTGTCTCTGAATGTCCTGGAAGG - Intronic
1066125543 10:32338254-32338276 GTGGATTTGAATGTACTAGATGG - Intronic
1066301325 10:34099943-34099965 GTGTGTGTGTGTGTACAGAAAGG - Intergenic
1067281467 10:44876706-44876728 GGGTGCGTGAGTGTACAGGAAGG + Intergenic
1068315080 10:55330866-55330888 GTGTATGTGTATGTGTATGAGGG + Intronic
1068544402 10:58329705-58329727 GTGTCTGTGAATTTAGAGAAAGG + Intergenic
1069203408 10:65652586-65652608 GTCTATGTGAATGTGCAGTGAGG + Intergenic
1069655883 10:70088129-70088151 GTGTGTGTGAGTGTGCAGGCGGG - Intronic
1069655886 10:70088186-70088208 GTGTGTGTGAGTGTGCAGGCGGG - Intronic
1069655889 10:70088243-70088265 GTGTGTGTGAGTGTGCAGGCGGG - Intronic
1071053453 10:81479691-81479713 ATGTAATTGAATGTATAGGAAGG - Intergenic
1071417727 10:85456817-85456839 GTGTGTGTAAAGGTCCAGGAAGG + Intergenic
1071584367 10:86805369-86805391 GTGTGTGTGTGTGTACAGGTAGG - Intronic
1072776661 10:98203250-98203272 GTGTATGTGTATGTAAAGAGAGG + Intronic
1073057391 10:100711149-100711171 GTGTGTGTGCGTGTACAGGAGGG - Intergenic
1074391263 10:113059913-113059935 GTGTGTGTGAAGGAACAGCAGGG + Intronic
1076119722 10:127925787-127925809 GGGAATGTGAGTGAACAGGAAGG + Intronic
1077370304 11:2178741-2178763 GTGCATGTGTGTGTACAGTAGGG + Intergenic
1077876021 11:6306852-6306874 GTGTCTGTCAAAGTACAAGAGGG + Intergenic
1079663806 11:23077380-23077402 AAGTATGTGAAGGCACAGGAGGG + Intergenic
1080139038 11:28892340-28892362 GTGTGTGTGTGTGTACAGGGAGG - Intergenic
1080179257 11:29403761-29403783 ATGTATGTGATTGTATATGAGGG + Intergenic
1080808026 11:35673857-35673879 GGGTATGTCAATGAACAGGCAGG - Intronic
1081342427 11:41944356-41944378 ATGTATCTGAATGTAAATGAGGG + Intergenic
1081410321 11:42750030-42750052 GTTTATGTGAATGGACATGTGGG - Intergenic
1081930283 11:46865286-46865308 AGGTATGAGAATGTACAAGATGG + Intronic
1082090213 11:48082901-48082923 GTGTATGTGAATGTGCTGTATGG + Intronic
1082176808 11:49069533-49069555 GTGTTTGTGAATTTATTGGATGG + Intergenic
1085344567 11:75759830-75759852 ATGAATGTGAATTTGCAGGATGG - Intronic
1085418562 11:76336326-76336348 GTGTGTGTGTGTGTACAGGAAGG - Intergenic
1086688900 11:89766340-89766362 GTGTTTGTGAATTTATTGGATGG - Intergenic
1086716955 11:90073620-90073642 GTGTTTGTGAATTTATTGGATGG + Intergenic
1087463479 11:98474449-98474471 GTGTGTGTGTGTGTAGAGGATGG - Intergenic
1087715412 11:101602948-101602970 GTGTGTGTGTATGTATAGCAAGG + Intronic
1088000431 11:104873655-104873677 GTGTGTGTGTGTGTACAGCAAGG - Intergenic
1088077688 11:105871982-105872004 ATGTATGTGAAAGTTAAGGAAGG + Intronic
1088384485 11:109238155-109238177 GTGCATGTGTATGTACATGCAGG + Intergenic
1090648955 11:128789690-128789712 GTGTGTGTGTCTGTGCAGGAGGG + Intronic
1091103567 11:132897947-132897969 GAGTATGTTAATATTCAGGAGGG + Intronic
1094734283 12:33216094-33216116 GTGTGTGTGTATGTACATGTAGG - Intergenic
1095129340 12:38520242-38520264 GTGTGTGTGTGTGTACAGGGAGG + Intergenic
1097975033 12:65676320-65676342 GTGTATGTGAGTGGGAAGGAAGG - Intergenic
1099408890 12:82299640-82299662 GTGTTAGTGGATGTCCAGGATGG - Intronic
1099742607 12:86660251-86660273 GTGTATGTGATTGAAGAAGAAGG + Intronic
1099990032 12:89710535-89710557 GTGTATATGCGTGTACAAGAAGG - Intergenic
1100070394 12:90709300-90709322 GTGTAAGTCAATGGACTGGAGGG - Intergenic
1100297259 12:93274510-93274532 GTGTATGTGAGTATTCAGGTGGG + Intergenic
1101687677 12:107042003-107042025 GTGTATGTTAAACAACAGGATGG + Intronic
1103445899 12:120994967-120994989 GTGGAGTTGAATGTACTGGATGG - Intronic
1105069979 12:133228342-133228364 GTGTGTGTGTGTGTCCAGGAGGG - Intronic
1105986238 13:25570473-25570495 GGGTGTGTGGAGGTACAGGAAGG + Intronic
1106289720 13:28349417-28349439 GTGTGTGTGTGTGTACAGCAAGG - Intronic
1106580046 13:31009928-31009950 GTGTGAGGGAATCTACAGGAGGG + Intergenic
1107005432 13:35604514-35604536 GTGTATATGCATGTATAGGGAGG - Intronic
1107950713 13:45459125-45459147 GTGTAACTGAATGGACACGAAGG - Intergenic
1109109540 13:58298860-58298882 ATGTATGTGAATGACAAGGAAGG + Intergenic
1109133466 13:58618045-58618067 GTGTATGTGCATGTACATGTGGG - Intergenic
1110812789 13:79829073-79829095 ATGTATATGGATCTACAGGAGGG + Intergenic
1111029949 13:82583610-82583632 GAGTATGTGTAGGTAGAGGAAGG - Intergenic
1114213118 14:20632788-20632810 GTGTCGGTCAATGCACAGGAAGG - Intergenic
1114728449 14:24964673-24964695 GTGTGTGTGTATGTAAAGGAAGG + Intronic
1114836062 14:26204191-26204213 GTGTATGTGATTGGACTGCAAGG + Intergenic
1115013303 14:28577325-28577347 GTGTATCTGAGTATAGAGGAAGG - Intergenic
1115304565 14:31920565-31920587 GTGTTTTTGAATGTACTGGCAGG + Intergenic
1116957061 14:50935618-50935640 GTGTGTGTGTGTGTACAGTAGGG + Intronic
1117146109 14:52838260-52838282 GTGAATGTGACTGTACTGAATGG - Intergenic
1117872940 14:60219701-60219723 GTGTGTGTGGAGGTACACGAGGG - Intergenic
1118067996 14:62213025-62213047 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118068010 14:62213147-62213169 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118579492 14:67280274-67280296 GTGTATGTGCACGTGCAAGAAGG - Intronic
1118893570 14:69928149-69928171 GTGTATCTGAATCTTCAGGCTGG + Intronic
1120500678 14:85293513-85293535 GTGTATGTGACTGCACATGTTGG + Intergenic
1120501756 14:85306279-85306301 GTGTGTGTGTGTGTACAGCAAGG + Intergenic
1122021477 14:98841368-98841390 GTGTATGTGAATATATGGGCAGG + Intergenic
1125998222 15:44184500-44184522 GTGTATGTAAATGTACACTAAGG - Intronic
1127822647 15:62673096-62673118 GTGTCTGTGTATAGACAGGAGGG + Intronic
1128262604 15:66243032-66243054 GTGTGTGTGTATGTAGAAGAGGG - Intronic
1128541150 15:68534217-68534239 GTGTATGTGTATGCACAAGGAGG - Intergenic
1128566505 15:68704021-68704043 GTGTATGTGTGTGTAGAGAAAGG - Intronic
1129273977 15:74433563-74433585 GTGTGTGTGAGTGTACACGCTGG - Intronic
1130429485 15:83832099-83832121 TGGTATGGGAATGGACAGGAAGG + Intronic
1133108578 16:3531673-3531695 GCGTATGTATATGTACAGAAAGG - Intronic
1135170751 16:20181310-20181332 GTGTGTGTGTGTGTATAGGAAGG - Intergenic
1135845370 16:25913773-25913795 GTGTATGTGGATGTGGAGGGAGG + Intronic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1137393029 16:48097370-48097392 ATGTTTGTGACTGTAGAGGAGGG + Intronic
1137607045 16:49793807-49793829 GTGGATGTGAATACACAGGGAGG + Intronic
1144153825 17:12478337-12478359 GTATATGTGTATATACACGATGG - Intergenic
1144343003 17:14326053-14326075 GTGTGTGTGCATTTTCAGGAAGG + Intronic
1144945560 17:18967909-18967931 GTGTGTGTGTGTGTATAGGAAGG - Intronic
1145017206 17:19407089-19407111 GTGTGTGTGTATGTACAGACAGG + Intergenic
1146553836 17:33805915-33805937 GTGTATATGGATGTGCAAGATGG - Intronic
1148839025 17:50482908-50482930 GTGTATGAGAATCTCCTGGAGGG + Intronic
1149338660 17:55664011-55664033 ATGTATGTGAGTGGACAGGTCGG + Intergenic
1151381793 17:73730786-73730808 TTCTATGGGAATGCACAGGATGG - Intergenic
1153196626 18:2605320-2605342 GTGTGTGTGTATGTACACAATGG + Intronic
1154190198 18:12224310-12224332 GTGTAGGTGAATGCAGACGAGGG - Intergenic
1155517798 18:26640577-26640599 GTGTCTGTGTGTGTCCAGGAGGG + Intronic
1155775677 18:29757464-29757486 GTGCATATGAATGTAAAGGTGGG + Intergenic
1156548817 18:37993392-37993414 GTGTTTGTGTGTGTACAGGTGGG + Intergenic
1157086921 18:44589976-44589998 GTGTATGTGTATGTGCATGTGGG + Intergenic
1158049806 18:53203245-53203267 GTGTATGTAATTATACAGAAAGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1163911771 19:20201797-20201819 GTGTGTGTGAATGTATAAAATGG + Intergenic
1163922657 19:20307166-20307188 GTGTGTGTGAATGTATAAAATGG + Intergenic
1163938036 19:20468055-20468077 GTGTGTGTGAATGTATAAAATGG + Intergenic
1164943499 19:32270079-32270101 GTGTATGTGTGTGTGTAGGAGGG - Intergenic
1166330923 19:42077566-42077588 GTGGCTGTGTATGAACAGGAAGG + Intronic
1166803147 19:45470176-45470198 ATGTGTGTGAGTGTAGAGGAAGG + Intronic
1167775523 19:51552098-51552120 GTGTATGTATATGTGCAGGCAGG - Intergenic
1167931818 19:52872309-52872331 GTGTATATTAATGTACTGAAGGG + Intronic
1202679592 1_KI270711v1_random:40449-40471 GTGTCTGGGAATGTAATGGATGG - Intergenic
925563656 2:5225736-5225758 GTGTGTTTAAATGTACTGGAAGG + Intergenic
926555162 2:14349194-14349216 GTGTATTAGAATATCCAGGAGGG + Intergenic
927341513 2:21989044-21989066 GTGTATGAGACTAGACAGGAAGG + Intergenic
927570674 2:24156664-24156686 GTTTATGGGAATGTTTAGGAAGG - Intronic
929091380 2:38220868-38220890 TTGTATGTGAATGTTCACAATGG + Intergenic
930559424 2:52942082-52942104 GCTTATGTGAAAGTACAGGATGG - Intergenic
931992705 2:67807197-67807219 GGGTCAGTGAATGTACATGATGG - Intergenic
932266001 2:70367365-70367387 GTGTCTGTGAATGTAGAGAAAGG + Intergenic
932735733 2:74252949-74252971 GTGTATGAGAATGGGCAGTAGGG - Intronic
933782046 2:85809571-85809593 GTGCAAGGAAATGTACAGGAAGG - Intergenic
934584341 2:95476916-95476938 GTGTTTGTGAATTTATTGGATGG - Intergenic
934595111 2:95599798-95599820 GTGTTTGTGAATTTATTGGATGG + Intergenic
934787655 2:97025729-97025751 GTGTTTGTGAATTTATTGGATGG - Intergenic
936174640 2:110209258-110209280 GTGAAGGTAAATGTACAAGAAGG + Intergenic
936854505 2:116940496-116940518 TTGTATGTGCCTGTACAGGTCGG - Intergenic
940113506 2:150181761-150181783 GTGTATGGGAATGTATGTGAAGG - Intergenic
941517335 2:166495284-166495306 TTGTGTTTGAATGTACAGAAAGG - Intergenic
942261942 2:174174003-174174025 GTGTGTGTGTATGTATGGGAAGG - Intronic
942871896 2:180744625-180744647 GTGTATGTGATTTTTCAAGAGGG - Intergenic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
945047749 2:205797070-205797092 GTGTATGTGAATGGTCATGTGGG + Exonic
945539758 2:211070253-211070275 GTGTGTTTGAATGCAAAGGAAGG + Intergenic
946512637 2:220375927-220375949 GTGTATGTGTATGTATGAGAGGG + Intergenic
947319542 2:228900766-228900788 CTGTTTGTGAATGGGCAGGAGGG + Intronic
948097255 2:235346107-235346129 GTGTGTGTGCATGCACATGATGG + Intergenic
948460038 2:238124595-238124617 GTGTACGTGTGTGTGCAGGAGGG + Intronic
948640485 2:239372782-239372804 GTGTATGTGTATGGAATGGAGGG - Intronic
948794069 2:240393166-240393188 GTGTGTGTGCATGCACAGGATGG + Intergenic
1168766385 20:384189-384211 GTGGATTTGAAAGTACAAGACGG - Intronic
1169553807 20:6728648-6728670 GTGTATGTGTGTGTAAATGAAGG + Intergenic
1169964505 20:11199754-11199776 GTGTTTGTGAGTGTGCATGATGG - Intergenic
1173695800 20:45010925-45010947 ATGTATCTGAATCTATAGGAAGG + Intronic
1174831312 20:53814804-53814826 GTGTTTGTAGATGTGCAGGAAGG + Intergenic
1175447942 20:59038020-59038042 TTGTTTCTAAATGTACAGGAAGG + Intronic
1175629279 20:60519618-60519640 GTGTAGAAGAATGTACAGGTAGG - Intergenic
1175781692 20:61686852-61686874 GGGATTGTGCATGTACAGGACGG + Intronic
1177723884 21:24942681-24942703 GTGTAAGTGTATGTAAATGAAGG + Intergenic
1183660968 22:39220873-39220895 GGGTAGGTGAATGGACAGGTGGG + Intergenic
1184045437 22:41969905-41969927 GTGGATGTGGCTGTGCAGGAGGG + Intergenic
1184303969 22:43582323-43582345 GTGTATGTGTATAGAAAGGAAGG - Intronic
1184412846 22:44335540-44335562 GTGTATGTGAGTGTGCGTGAGGG + Intergenic
1184491699 22:44813411-44813433 GTGTAAGTGTATGTACATGTAGG - Intronic
1184491706 22:44813482-44813504 GTGTAAGTGTATGTACATGTAGG - Intronic
950495891 3:13334425-13334447 GTGTGTGTGCATGTGCAGGCAGG + Intronic
951264036 3:20546855-20546877 GTGTATGTGAGTGTTTAGGGGGG + Intergenic
951967938 3:28409055-28409077 GTGTTTGTGAATGAATAAGATGG - Intronic
952204060 3:31162091-31162113 GTGTGTGTGTGTGTACTGGAAGG - Intergenic
952909782 3:38173607-38173629 GTGAATGTTAATGTACATGATGG + Intronic
953259454 3:41323377-41323399 GTGTGTGTTATTGTTCAGGAAGG - Intronic
953396084 3:42571466-42571488 GTGTATGTGAATGTACAGGATGG + Intronic
953660998 3:44891504-44891526 GTGTGTGTGTGTGTAGAGGAGGG - Intronic
953695636 3:45156221-45156243 GTGTATGTGTATCTACACAATGG - Intergenic
953780835 3:45869122-45869144 GTGCATGTGCATGGGCAGGAAGG + Intronic
955177765 3:56633840-56633862 GTGTCTGTAAATGGAGAGGATGG + Exonic
956519879 3:70092301-70092323 GTATATGAGAATATACATGATGG + Intergenic
957721155 3:84001009-84001031 GTGTATGTGTATGTATATGTGGG + Intergenic
957988742 3:87604552-87604574 GTGTGTGTGTGTGTGCAGGAGGG + Intergenic
958803149 3:98779463-98779485 ATGTATTTTAATGTACATGATGG + Intronic
960602047 3:119468578-119468600 GTGTGTGTGTGTGTACAGCACGG - Intronic
961550362 3:127667457-127667479 GTGACTGTGCATGTTCAGGAGGG + Intronic
961930832 3:130531007-130531029 GTGTGTGTGTGTGTAGAGGAGGG - Intergenic
962113336 3:132473675-132473697 GTGTATGTGTGTGTCCAGGAAGG - Intronic
962898245 3:139735233-139735255 GTTTATTTGAATGAAGAGGAAGG - Intergenic
963099978 3:141591849-141591871 CTGTATGTGAAAATACAGGTAGG - Intronic
963329199 3:143895166-143895188 GAGTGTGTGGATGTAAAGGATGG - Intergenic
963567559 3:146948477-146948499 GTGTTGATGAATGTCCAGGAAGG - Intergenic
963686981 3:148448157-148448179 GTGTATGTGAAGGCAGAAGAGGG + Intergenic
964982842 3:162707652-162707674 GTTTATGTAAATGTAGAGAAGGG + Intergenic
966160799 3:176966191-176966213 GTCTGTGTGAATCTGCAGGAGGG + Intergenic
966240268 3:177748069-177748091 GTGTGTGTGGATGTGTAGGAGGG + Intergenic
967263694 3:187671083-187671105 GTGTGTGTATATGTACGGGAGGG + Intergenic
967878948 3:194285643-194285665 GTGTGTGTGTGTATACAGGAGGG + Intergenic
968315948 3:197725667-197725689 GAGAATCTTAATGTACAGGAGGG + Intronic
970091475 4:12413161-12413183 GTGTATGTATGTGTTCAGGATGG + Intergenic
970289492 4:14555629-14555651 GTGTATGAGAAAGTTCATGATGG + Intergenic
970399602 4:15704592-15704614 GTGTGTGTGAGTGTGAAGGAGGG + Intronic
970789584 4:19840831-19840853 GTGTACGTGTATGTGCAGGGGGG - Intergenic
971328221 4:25661688-25661710 GTGTATGTGAATATATATGCAGG - Intronic
971500346 4:27311991-27312013 GTGTATGTGTGTGTGCAGCAGGG + Intergenic
971810842 4:31424999-31425021 GTGGAAATGAATGTACAGTATGG + Intergenic
972086741 4:35226880-35226902 GTGTGTGTGTGTGTGCAGGAGGG + Intergenic
972937178 4:44151012-44151034 GTTTATGTGGATTCACAGGAAGG + Intergenic
973255002 4:48101666-48101688 GTGTATGTGTATATAAAGCATGG - Intronic
974799198 4:66793749-66793771 GTGGATGTGAGTATTCAGGAAGG - Intergenic
976674530 4:87689999-87690021 GTGTGTGTGTATGTACATGTGGG + Intergenic
977171917 4:93772686-93772708 GTGGAGGAAAATGTACAGGAAGG - Exonic
978764783 4:112392881-112392903 CTGTATCTGAAAGAACAGGAAGG + Intronic
978990483 4:115075881-115075903 GTGTATGTGTGTGTAAAGAATGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983184587 4:164687507-164687529 GTGTATGAGAAAATATAGGATGG - Intergenic
986745582 5:10741756-10741778 GTGTCTGTGAATGACCACGAAGG - Intronic
987670964 5:21008000-21008022 GTGTATGTGTTTGTATAGGCCGG + Intergenic
989359019 5:40578281-40578303 GTGTATGTGCATGCATTGGACGG + Intergenic
989759591 5:44997129-44997151 CTGTATGTGTATGTACAAGTGGG + Intergenic
990407387 5:55504616-55504638 GTGTATGTGTATGTATATGTAGG - Intronic
991030277 5:62075184-62075206 GTGTGTGTGTATGCAGAGGAAGG + Intergenic
992414266 5:76537967-76537989 TTGTATTTGAGTGTAGAGGAGGG + Intronic
997351758 5:133236133-133236155 GTGGATGTGAAGGCTCAGGAAGG - Intronic
997424691 5:133795184-133795206 GTGAAGCTGAATGTACAGGCTGG + Intergenic
997776215 5:136608188-136608210 GTGAATATCAATTTACAGGAAGG + Intergenic
1000313324 5:160065351-160065373 GTGTGTGTGTATGATCAGGAAGG - Exonic
1000434559 5:161192354-161192376 GTTTATGGGAATCTTCAGGAAGG - Intergenic
1000756114 5:165162138-165162160 GTGTGTGTCTATGTACATGAAGG - Intergenic
1001097105 5:168784089-168784111 GTGTGTGTGTGTGTGCAGGAAGG - Intronic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1002923116 6:1587225-1587247 GTGTATGAGAGTGTGCATGAGGG + Intergenic
1003376702 6:5585311-5585333 GTGTAAGTGTATGTATAGTAAGG + Intronic
1004002778 6:11610764-11610786 CTGTATGTGAATGAGCAGCAAGG - Intergenic
1005743951 6:28818772-28818794 GTGTGTGTGCATGTAAATGATGG + Intergenic
1006480072 6:34285297-34285319 GTGTGTGTGTATGTACAGAAGGG - Exonic
1006745115 6:36336274-36336296 CTTTATGTGAAGGTACATGAGGG - Intronic
1007075545 6:39063889-39063911 GTGTGTGTGTGTGTACACGATGG - Intronic
1007993157 6:46278370-46278392 GTGTGTGTGTGTGTAAAGGATGG - Intronic
1008813606 6:55535874-55535896 GTGTATGTGAGGGTGCACGAAGG - Intronic
1008912857 6:56755452-56755474 GTATATGTGAATGTAAAGTGGGG - Intronic
1010739146 6:79479478-79479500 GTGTGTGTGTATGTACTTGATGG - Intergenic
1010834170 6:80566460-80566482 GTGTGTGTGAATATACTGGGGGG - Intergenic
1012495959 6:99833704-99833726 GTGTATGTGAGTGTGCATGCAGG + Intergenic
1013632641 6:112000233-112000255 GTTTATGAGAATGTAAAAGAGGG + Intergenic
1014215654 6:118750462-118750484 GAATAGGGGAATGTACAGGATGG - Intergenic
1015166151 6:130202270-130202292 GTATGTGTCAATGTACAGGAGGG - Intronic
1015429248 6:133111121-133111143 GTGTGTGTGAATGTACAGATGGG + Intergenic
1015493702 6:133857557-133857579 GTGTGTGTGTATGCAGAGGAGGG - Intergenic
1016272570 6:142305421-142305443 GTGTGTGTGTGTGTACAGGAGGG - Intronic
1016772316 6:147865284-147865306 GTGTATATGTATGTACATGTAGG + Intergenic
1019367772 7:644142-644164 GTGTAGGTGAGGGCACAGGAGGG - Intronic
1020618124 7:10485490-10485512 GTGAATGTAAAACTACAGGAGGG - Intergenic
1021310926 7:19094814-19094836 ATGTAAGGGAATGTACTGGATGG - Intronic
1021760669 7:23900448-23900470 GTGTATGTATATTAACAGGAAGG + Intergenic
1022335898 7:29421711-29421733 ATGTACGTGAATGTCCATGAAGG + Intronic
1022609737 7:31857678-31857700 TTGTAAGTGAATGTCCAGGTGGG - Intronic
1024436273 7:49359047-49359069 GTGTATGTGAATGTGGGGGTTGG - Intergenic
1026067324 7:67086442-67086464 GTGTATGTGAATGTGTGTGAGGG + Intronic
1027698023 7:81435432-81435454 GTGTGTGTGTATGTAGATGAGGG - Intergenic
1030643211 7:112029199-112029221 GTGAATGTGCAAGTACAGAAAGG + Intronic
1030739676 7:113093389-113093411 GTGCATGTGAATGTATTGGAAGG + Intergenic
1030924962 7:115440538-115440560 GAGTAGCTGAATGTAAAGGAAGG - Intergenic
1031408575 7:121415045-121415067 GTGTGTGTGTGTGTTCAGGATGG - Intergenic
1032140186 7:129322117-129322139 GTGTGTGTGTGTGTATAGGAAGG + Intronic
1032162545 7:129521857-129521879 GTGTATCTCCATGTACACGAGGG + Intergenic
1032402500 7:131633569-131633591 GTGTATGTGTGTGTGCAGGGTGG + Intergenic
1032960077 7:137022221-137022243 GTGTATGTGTGTGTTAAGGAGGG - Intergenic
1033899612 7:146119535-146119557 GTGTATCTACATTTACAGGAAGG - Intronic
1035048853 7:155986749-155986771 GTGTTTGTGAAGGTTCTGGATGG + Intergenic
1035295777 7:157866474-157866496 GTGTGTGTGTGTGTACACGAGGG - Intronic
1036662825 8:10718912-10718934 CTGTATGTGAATGCATAGGAGGG - Intergenic
1037457569 8:19079107-19079129 CTGTGTGTGAATGTTGAGGATGG + Intronic
1038335588 8:26643023-26643045 GATTGTGTGAATGAACAGGAAGG + Intronic
1039559692 8:38503335-38503357 GTGTGTGTGAGTGTACATGAGGG + Intergenic
1041088316 8:54278362-54278384 GTGTGTGTGAATGTGCATGTGGG - Intergenic
1041704659 8:60833076-60833098 GTGGATGAGAATGAACAGTACGG - Intronic
1046528493 8:115413364-115413386 GTGCATGTGTATGTACAGGCAGG + Exonic
1047677996 8:127223936-127223958 TTGTATGTGCATGTGCACGAAGG - Intergenic
1049525551 8:143124738-143124760 ATGTATGTGAATGTACGTGTGGG - Intergenic
1049772366 8:144389389-144389411 CTGTCTGTGAAGGTAAAGGATGG - Intronic
1050776041 9:9261662-9261684 GTGTGTGTGTGTGTTCAGGAGGG + Intronic
1051480175 9:17550933-17550955 GTGTATGTGTGTGTATATGATGG + Intergenic
1053553063 9:39104459-39104481 GTGTATGTGTATGTGCAGGAAGG - Intronic
1053817181 9:41924638-41924660 GTGTGTGTGTGTGTGCAGGAAGG - Intronic
1054107431 9:61068288-61068310 GTGTGTGTGTGTGTGCAGGAAGG - Intergenic
1054613426 9:67262837-67262859 GTGTGTGTGTGTGTGCAGGAAGG + Intergenic
1055822927 9:80289504-80289526 GTGTGTGTGAATGTTGAAGAAGG - Intergenic
1056709061 9:88976055-88976077 GTGTATCTGTGTGTACAGCAGGG - Intergenic
1056848890 9:90064127-90064149 GTGTTTGTGAGGGTTCAGGAAGG + Intergenic
1058445649 9:105052607-105052629 GTGTATGTGTGTGGTCAGGAGGG - Intergenic
1058527824 9:105878014-105878036 GTGTTTGTGAATGAGCAGGCAGG - Intergenic
1058840280 9:108900576-108900598 GTGTATGTGAATGTGCATGAGGG - Intronic
1059822724 9:117992045-117992067 GTGTATGTGCTTTTACAAGAGGG + Intergenic
1060112426 9:120916014-120916036 GTGTATGTGAATGTTCATGGCGG + Intronic
1185930939 X:4202747-4202769 GTGTCTGTGTATATCCAGGAAGG + Intergenic
1188648526 X:32599712-32599734 GTGTATGTGTATGTACAATCTGG - Intronic
1188933936 X:36150075-36150097 GTGTATGTGTGTGTAAATGATGG + Intergenic
1189798389 X:44668513-44668535 GTGTTTGTGCATGTAGAGGATGG - Intergenic
1189882775 X:45509254-45509276 ATGCATGTGTATGTTCAGGAGGG + Intergenic
1189939022 X:46101756-46101778 GTGCATGTCTATGTCCAGGATGG + Intergenic
1190113430 X:47609934-47609956 GTGGAAGGGAATGTACTGGATGG + Intronic
1190264448 X:48819195-48819217 GTGTATGTGACTGTGCAGGATGG + Intronic
1190741663 X:53292805-53292827 GTGTGTGTGTGTGTACGGGAGGG + Intronic
1192881269 X:75285912-75285934 GTTTTTGTGAAGGTAAAGGAAGG + Intronic
1193090655 X:77490721-77490743 GTGTGTGTGTGTGTACAGCAGGG + Intergenic
1194809491 X:98373309-98373331 GTGGATGTGAGAGAACAGGAGGG + Intergenic
1195456043 X:105070855-105070877 GTGTATGTAAATGCATAGAAAGG - Intronic
1195773355 X:108376073-108376095 GTGTGTGTGAATGTATAAAATGG - Intronic
1197173372 X:123458780-123458802 GTGTAGGAGAATGGGCAGGATGG - Intronic
1197460351 X:126733859-126733881 GACTATTTGAATGCACAGGAAGG + Intergenic
1199251942 X:145673836-145673858 GTGTGTGTGTGTGTACAGAATGG + Intergenic
1199693363 X:150326120-150326142 GTGTATTTGATTGTAGTGGAGGG - Intergenic