ID: 953400684

View in Genome Browser
Species Human (GRCh38)
Location 3:42612802-42612824
Sequence AACGATATGATTCTACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953400682_953400684 30 Left 953400682 3:42612749-42612771 CCAGTTTGTAATATAAGGTGTCT 0: 1
1: 0
2: 0
3: 4
4: 127
Right 953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953400684 Original CRISPR AACGATATGATTCTACTGCC TGG Intronic
914781706 1:150791516-150791538 AAGGAACTCATTCTACTGCCAGG + Intergenic
914896624 1:151681011-151681033 AAGGATATGAATGTCCTGCCAGG - Intronic
917604691 1:176614777-176614799 AACCATATATTTATACTGCCTGG - Intronic
917665939 1:177225873-177225895 AACCATATGATTCCAAGGCCAGG + Intronic
1063442872 10:6087485-6087507 ACCGATATGATTCTACTTATTGG + Intergenic
1065873472 10:29976374-29976396 AACCATAGGGTTGTACTGCCAGG + Intergenic
1069824045 10:71244482-71244504 AAGGATATGACTCTTCTGCCTGG - Intronic
1092322627 12:7494223-7494245 AACCATGTGATTATATTGCCTGG + Intronic
1095201294 12:39387461-39387483 AAAGATCTTTTTCTACTGCCAGG + Intronic
1101304979 12:103519427-103519449 ATAGATATGTTTTTACTGCCTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1124848533 15:33313740-33313762 AAAGATATGATTCTATTCCATGG - Intronic
1144605066 17:16657784-16657806 AACCATATCATTCTGCTGCTGGG + Intergenic
1150302517 17:64058083-64058105 AAGGATATGACTGTACTGCAGGG + Intronic
1153209868 18:2749434-2749456 AAAGATATGATTCTAGTTTCTGG + Intronic
1154465440 18:14639534-14639556 AACGATATTCTTCTAGTGCTTGG - Intergenic
1156185331 18:34655814-34655836 AACGTTATGAGTCTCCTGGCAGG - Intronic
1157188573 18:45561159-45561181 AACCATAAGACTCTTCTGCCTGG - Intronic
1163987531 19:20967747-20967769 AATGATTTGACTCTCCTGCCTGG + Intergenic
1164078598 19:21843269-21843291 AGCGATTTGACTCTCCTGCCTGG - Intronic
1164128300 19:22338368-22338390 AGTGATTTGACTCTACTGCCTGG - Intergenic
1164128452 19:22339812-22339834 AACGATGTGACTCTCCAGCCTGG - Intergenic
1164171181 19:22726958-22726980 AGTGATTTGACTCTACTGCCTGG + Intergenic
1164201635 19:23023998-23024020 AATGATGTGACTCTCCTGCCTGG - Intergenic
1164233119 19:23308539-23308561 AGTGATGTGATTCTTCTGCCTGG + Intronic
1164234298 19:23318766-23318788 GGTGATGTGATTCTACTGCCTGG + Intronic
1164249082 19:23461295-23461317 GGCAATGTGATTCTACTGCCTGG + Intergenic
1164266653 19:23625045-23625067 CAAGATATGATTCAATTGCCTGG + Intronic
1164283078 19:23786356-23786378 AGTGATATGATTTTGCTGCCTGG + Intronic
1164302928 19:23977786-23977808 GGTGATGTGATTCTACTGCCTGG - Intergenic
1164325687 19:24189371-24189393 GGCGATGTGATTCTTCTGCCTGG - Intergenic
1166773887 19:45300873-45300895 AATGATAGCATTCTACTTCCCGG - Intronic
936408428 2:112230325-112230347 GATGATATGATTCTACTCCTTGG + Intronic
936903051 2:117505763-117505785 AAAGATATGACTGTACAGCCTGG + Intergenic
942070994 2:172315243-172315265 AAAGAAAAGATTCTGCTGCCGGG - Intergenic
944466001 2:200000118-200000140 TAGGATATGGTTCTACTGCCTGG + Intronic
946084799 2:217159837-217159859 AATGATATGAGTCTAGGGCCGGG - Intergenic
1174725905 20:52861865-52861887 AACTTTATAATTCTACTCCCTGG - Intergenic
1176809100 21:13518870-13518892 AACGATATTCTTCTAGTGCTTGG + Intergenic
1178408270 21:32343424-32343446 CACTATATGATTATACTGCACGG + Intronic
949296444 3:2530051-2530073 AAGGTAATGATTCCACTGCCAGG - Intronic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
953984168 3:47428574-47428596 AACGAAATACATCTACTGCCAGG + Exonic
957237942 3:77619497-77619519 AACGCTATGATTCCACTGAGAGG - Intronic
960732222 3:120739864-120739886 AGCTATACAATTCTACTGCCTGG - Intronic
961537621 3:127579615-127579637 AACGATATCATTTAACTGCCTGG + Intronic
963513852 3:146283022-146283044 AACCTCATGATTCTACTACCTGG - Intergenic
964309579 3:155378295-155378317 AAAGACATGATTCTACAGTCAGG - Intronic
974200322 4:58629434-58629456 AAAGATATGATTTTACTACAGGG + Intergenic
976407694 4:84678465-84678487 AACGAGATGTTTCTCCAGCCTGG - Intronic
978075261 4:104520882-104520904 ATGGATATAATTATACTGCCAGG + Intergenic
983165210 4:164467749-164467771 AAAGATATGATTCAACATCCAGG + Intergenic
983567051 4:169164363-169164385 AAAAAGATGATTCTACTGACAGG + Intronic
987246641 5:16055692-16055714 AACAACATGATTCTACTTACAGG + Intergenic
992963868 5:81982412-81982434 ACCGATATCATGCCACTGCCTGG + Intronic
996894703 5:128466328-128466350 AATGATATTATTCTACTCCAAGG + Intronic
998242319 5:140458252-140458274 AACAAGATTATACTACTGCCAGG - Intronic
998728998 5:145052782-145052804 GCCTATATGATTCTATTGCCTGG + Intergenic
1000609726 5:163360627-163360649 AACCATATCATTCTACCCCCTGG - Intergenic
1002451946 5:179323935-179323957 AAAGATATGATTCCATTGCATGG - Intronic
1004296187 6:14413621-14413643 AATGATATGATTCTACTTATAGG - Intergenic
1005225483 6:23637381-23637403 ATCTATATGAATCTACAGCCAGG + Intergenic
1006619953 6:35356841-35356863 AACAATATGCTTCTATTACCAGG - Intronic
1006667290 6:35704843-35704865 AACCATTTGATTCTGCTGGCCGG + Intronic
1012198268 6:96372460-96372482 AATTATTTGTTTCTACTGCCTGG + Intergenic
1015071745 6:129102772-129102794 AACTTTCTGATGCTACTGCCAGG + Intronic
1021142244 7:17040990-17041012 AAAAATATCATTCTACTTCCTGG - Intergenic
1024539227 7:50462477-50462499 AAGGATATGTTTCGACTACCGGG - Intronic
1024912325 7:54459372-54459394 AACTATTGGACTCTACTGCCAGG + Intergenic
1025751592 7:64298562-64298584 AATGATGTGACTCTTCTGCCTGG - Intergenic
1025758638 7:64369780-64369802 AATAATATGATTCTCTTGCCTGG + Intergenic
1032887992 7:136163021-136163043 AAATACATGATTATACTGCCTGG + Intergenic
1034049952 7:147972450-147972472 AAGGATAAGATTAAACTGCCTGG + Intronic
1040357860 8:46637101-46637123 AATGATATGACTCTCTTGCCTGG + Intergenic
1040359266 8:46649718-46649740 AATGATATGACTCTCTTGCCTGG + Intergenic
1040374785 8:46814597-46814619 GATGATGTGATTCTCCTGCCTGG + Intergenic
1040375189 8:46817962-46817984 AAAGATATGACTCTCTTGCCTGG + Intergenic
1040379792 8:46861341-46861363 AATGATATGACTCTCTTGCCTGG + Intergenic
1041597616 8:59675360-59675382 AAAAATATGATTCTAGTCCCTGG + Intergenic
1044351830 8:91175622-91175644 CACCATATAATTCTACTGCTTGG - Intronic
1044920002 8:97159357-97159379 TACTATATGATTCTACTTACAGG - Intergenic
1047262701 8:123275829-123275851 AACGATCAGATTCCACGGCCAGG - Intergenic
1057965233 9:99496817-99496839 AACGATAGGATGCTATTGCAGGG + Intergenic
1061328290 9:129877220-129877242 TAGGAAATGATTCTGCTGCCTGG + Intronic
1187453876 X:19423793-19423815 AACGATATGATTCATCTTCGGGG + Intronic
1193907467 X:87260773-87260795 AACGATATGAATTTAATACCAGG - Intergenic
1200843747 Y:7810431-7810453 AAAGATATGACTCTTCTGACTGG - Intergenic
1200850697 Y:7880284-7880306 AATGATATGATTTTCTTGCCTGG - Intergenic
1200856311 Y:7942275-7942297 AATGATATGACTCTCTTGCCTGG - Intergenic
1200858490 Y:7964863-7964885 AACAATATGACTCTCTTGCCTGG - Intergenic
1200858714 Y:7966926-7966948 AACAATATGACTCCTCTGCCTGG - Intergenic
1200892301 Y:8336961-8336983 AATGATATGACTCTTCTGCCTGG + Intergenic
1200894542 Y:8360848-8360870 AATGATGTGACTCTTCTGCCTGG - Intergenic
1200894769 Y:8363408-8363430 AATAATATGACTCTTCTGCCTGG - Intergenic
1200902831 Y:8450311-8450333 GATGATATGATTCTTCTTCCAGG + Intergenic
1201336125 Y:12881587-12881609 AAATATATGATTCCACTTCCAGG - Intergenic
1202080815 Y:21082456-21082478 AGGGATTTGATTCTTCTGCCTGG + Intergenic
1202245829 Y:22819118-22819140 AATAATATGACTCTTCTGCCTGG + Intergenic
1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG + Intergenic
1202263026 Y:22989606-22989628 AATGATATGACTCTCTTGCCTGG + Intronic
1202398817 Y:24452866-24452888 AATAATATGACTCTTCTGCCTGG + Intergenic
1202413706 Y:24601218-24601240 AATGATATGACTCTCTTGCCTGG + Intergenic
1202416016 Y:24623347-24623369 AATGATATGACTCTCTTGCCTGG + Intronic
1202454771 Y:25046739-25046761 AATGATATGACTCTCTTGCCTGG - Intronic
1202457079 Y:25068868-25068890 AATGATATGACTCTCTTGCCTGG - Intergenic
1202471963 Y:25217220-25217242 AATAATATGACTCTTCTGCCTGG - Intergenic