ID: 953403184

View in Genome Browser
Species Human (GRCh38)
Location 3:42644784-42644806
Sequence GTGGAGATCTGCAGGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953403184_953403194 14 Left 953403184 3:42644784-42644806 CCATCTACCCTGCAGATCTCCAC 0: 1
1: 0
2: 1
3: 18
4: 220
Right 953403194 3:42644821-42644843 CCTCCCTGATGCCTAATCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953403184 Original CRISPR GTGGAGATCTGCAGGGTAGA TGG (reversed) Intronic
900795269 1:4703967-4703989 GTGGGGAGAAGCAGGGTAGAGGG - Intronic
900915616 1:5636126-5636148 GGGGAGATGTGGAGGGTAGGGGG - Intergenic
900997783 1:6131741-6131763 TTGGTCATCTGCAGGGGAGACGG + Exonic
906104987 1:43286244-43286266 GTGGGGACTTGCAGGGTAGAGGG - Intergenic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
907331070 1:53672054-53672076 GTGGCCAACTGCAGGGTAGGAGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910876992 1:91886638-91886660 GGGGAGCTCTGCTGGGGAGAGGG - Intronic
913662509 1:121016788-121016810 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914013887 1:143799984-143800006 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914163936 1:145161213-145161235 GTGTAATTCTGCAGGGCAGAAGG - Intergenic
914341960 1:146767288-146767310 GAGGAGACCTGCAGGTTGGATGG + Intergenic
914652510 1:149708603-149708625 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
915213137 1:154324794-154324816 GCGGGCATCTGCAGGGTGGAGGG + Exonic
916796620 1:168173416-168173438 GTAGAGATCTGCTGGTAAGAAGG - Intergenic
918809274 1:189094381-189094403 GTGGAGTTTGGCAGGGGAGACGG + Intergenic
918904710 1:190477537-190477559 GTAGTGAGCTGCAGGGTAGTAGG + Exonic
920054218 1:203180963-203180985 AAGGTGATCTGCAGGGTAAATGG - Intronic
920349313 1:205327481-205327503 GTGTAGATTTGCAGTCTAGAGGG + Intergenic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
921977608 1:221219666-221219688 GTGGAGTTTTGCTGGGTTGACGG + Intergenic
924149573 1:241114903-241114925 ATGAAGATCAGCAGCGTAGAGGG - Intronic
1063646463 10:7888518-7888540 GTGGAGGTCTGCAGTGTGGAGGG + Intronic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1066180843 10:32958785-32958807 ATGGAGCCCTGCAGGGTAGGGGG - Intronic
1066315533 10:34242354-34242376 TTGGACACCTGCAGGCTAGAGGG - Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069601927 10:69713473-69713495 AGGGAGACCTGCAGGGTAGAGGG + Intergenic
1069930798 10:71880433-71880455 GTGGAGAGGTGGAGGGGAGAAGG - Intergenic
1070326831 10:75395295-75395317 GTGGAGAAGAGCAGGGGAGACGG + Intergenic
1070468807 10:76756196-76756218 CTAGAGACCTGCAGGGTAGGTGG + Intergenic
1072662554 10:97371620-97371642 GCTGAGATCTGCAGGGTTGCTGG + Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1076863168 10:133151860-133151882 ATGAAGATCAGCAGGGAAGAGGG - Intergenic
1078367003 11:10715167-10715189 GTGGAGATCTACAGGGTCAGTGG + Intergenic
1078444787 11:11395974-11395996 GTGGAGATGGGGAGGGGAGAGGG + Intronic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1080883268 11:36342318-36342340 CTGGAGATCAGTAGGGCAGACGG + Intronic
1081003362 11:37702475-37702497 GTGGCTCTCAGCAGGGTAGATGG - Intergenic
1081633084 11:44702542-44702564 GTGGAGATGGGCAGTGGAGATGG + Intergenic
1083226529 11:61288452-61288474 GTGGGTAGCTGCTGGGTAGAAGG - Intronic
1083285454 11:61655978-61656000 GTGGAGTTGGGCAGGGGAGAAGG - Intergenic
1083307863 11:61770231-61770253 GTGGGGCTCTGCAGGAGAGATGG - Exonic
1083929464 11:65832932-65832954 GTTGAGGTCTGCTGGGGAGAAGG - Intronic
1084117697 11:67051576-67051598 GGGGAGTTCTGAAGGGTAGAAGG + Intergenic
1084205063 11:67586374-67586396 AAGGAGATCTGCAGGGCAGGGGG - Exonic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1087229921 11:95649402-95649424 GTGGATATCTGCTGGGCAAATGG - Intergenic
1087434020 11:98090156-98090178 GTGGAGATTTAAAGGGTAAACGG + Intergenic
1090580016 11:128149139-128149161 ATGCACATCTGCAGGGTAAACGG - Intergenic
1090963517 11:131578456-131578478 GGGGAGAGCTGCAGGGAAGTGGG + Intronic
1091172610 11:133531867-133531889 GTTGGGACCTGCAGGGTGGAAGG - Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091335565 11:134763082-134763104 GTGGAGAGCTGCGGGGCCGAGGG - Intergenic
1094235900 12:28165885-28165907 GAGGAGATTTATAGGGTAGATGG + Intronic
1095743385 12:45631121-45631143 TTGAAAAGCTGCAGGGTAGATGG - Intergenic
1096973998 12:55688182-55688204 GTGGTGAGCTGCAGGGTTGGGGG - Exonic
1100811135 12:98339492-98339514 GTGGAGGTGTGCAGGGTTGGTGG - Intergenic
1101062773 12:100988994-100989016 GTGGAGCTCTGCAGGGCAAAGGG + Intronic
1101293553 12:103396811-103396833 GGGGAGACCAGTAGGGTAGAGGG + Intronic
1104093808 12:125537957-125537979 GTGGAGATCTGCAGAGTTTCGGG - Intronic
1104280741 12:127374262-127374284 GTGGAGATCTGCAGAGTTTCAGG + Intergenic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106533639 13:30618287-30618309 GTGGAGATGGGCAGGGTTAACGG + Intronic
1107102989 13:36614204-36614226 GTGGAGAGCGGAAGGATAGAGGG - Intergenic
1110433895 13:75458190-75458212 GTGGATCTCTGCAGGATGGATGG + Intronic
1112131661 13:96531559-96531581 GTGCAGGTCAGCAGGGCAGAGGG + Intronic
1112679470 13:101746007-101746029 GCGGAGATGTGCAGGATAGATGG + Intronic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1117755567 14:58970906-58970928 GTGGAGAACTACAGGGTAACTGG + Intergenic
1119425560 14:74532541-74532563 GTTGATATCTGCAGGGTTGGAGG + Exonic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1121480580 14:94267985-94268007 GTGGTTTTCTGCAAGGTAGATGG + Intronic
1121939403 14:98055499-98055521 ATGCAGGTCTGCAGGGTACAAGG + Intergenic
1122625210 14:103081961-103081983 ATGGAGATGTGAATGGTAGATGG + Intergenic
1122628797 14:103098045-103098067 GTTGGGAGCTGCAGGGTCGAAGG + Intergenic
1126423200 15:48497759-48497781 GTAGAGTAGTGCAGGGTAGATGG - Intronic
1130298852 15:82665440-82665462 GTGGAGGTCAGCGGGGTGGAGGG - Exonic
1131048744 15:89333138-89333160 GTGGAGGTCTGCTTGGCAGAGGG - Exonic
1133059356 16:3164440-3164462 ATGCAGATCTGCAGGGGAGTGGG + Intergenic
1135059838 16:19262036-19262058 GTGGATATCTGCAGTATAGGGGG + Intronic
1136636720 16:31528998-31529020 GTGCAGAGCTGCAGGGGAGGGGG + Intergenic
1137580723 16:49632102-49632124 GTGGGGATCTGCAGGATCAATGG + Intronic
1138268514 16:55677981-55678003 GGGAAGATCTGTAGGGCAGAAGG - Intronic
1139992315 16:70950137-70950159 GAGGAGACCTGCAGGTTGGATGG - Intronic
1141230990 16:82167427-82167449 GTGGAGAGGGGAAGGGTAGATGG + Intronic
1144967526 17:19087440-19087462 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1144980393 17:19164625-19164647 GTGGAAAGCAGCAGGGAAGAGGG + Intergenic
1144987829 17:19213607-19213629 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1146574504 17:33979391-33979413 GTGGAGCTCGGCTGGGTGGAGGG - Intronic
1146593076 17:34145561-34145583 GTGGATATCGGCAGACTAGAAGG - Intronic
1146719824 17:35116254-35116276 GTAGAGGTGTGCAGGGTGGAAGG - Intronic
1147648101 17:42046071-42046093 GTGGGGATCAGCATGGCAGAAGG - Intronic
1148921175 17:51036188-51036210 GTGGAGATTGGCAGAGCAGAGGG - Intronic
1150612504 17:66745122-66745144 GTGGACATCTGTTGGGGAGAGGG + Intronic
1151077177 17:71287357-71287379 GTGGAGATCTGGAGGGAAAGGGG + Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1152738326 17:82008228-82008250 GTGGGAGACTGCAGGGTAGACGG + Intronic
1153369186 18:4294813-4294835 GTGGAACTCAGCAGGATAGATGG + Intronic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1160535881 18:79591096-79591118 GAGGAGAGCTGCAGGGTGGGGGG - Intergenic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1163160234 19:15459930-15459952 GCTGAGATCTGAAGGGTGGATGG - Intronic
1163435529 19:17292945-17292967 GTGGAGAGATGCAGGGTAGATGG - Intronic
1163734479 19:18970834-18970856 GTGGAGCTCTGCTGGGTGGGTGG + Intergenic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1163832693 19:19554600-19554622 TGGGAGAGCTGGAGGGTAGACGG - Intergenic
1164480565 19:28608191-28608213 GAGGAGATCGGCAGCGTTGAAGG - Intergenic
1165306299 19:35005031-35005053 CTGGAGACCTGCAGGGTCCAAGG + Intronic
1166201474 19:41240232-41240254 GTGGATATATGGAGGGTGGATGG + Intronic
1167711131 19:51111736-51111758 GTGGAGATATGCAGGAAAGTGGG - Intergenic
1167958949 19:53090658-53090680 GGGGAGGCCTGCAGGATAGAGGG + Intronic
925031924 2:656930-656952 AAGGAGATCATCAGGGTAGAAGG - Intergenic
926149133 2:10415064-10415086 GTGGAGATGTGCAGGGTTTGGGG + Intronic
927051452 2:19333799-19333821 AATGAGATCTGCAGGTTAGATGG + Intergenic
927838418 2:26420482-26420504 TTGGAGATCTGCTGGGGACAAGG + Intronic
929298269 2:40272400-40272422 GAGGAGGTCTGTAGGGTAGGAGG - Intronic
931463217 2:62466079-62466101 AGGGAGCTCTGCAGGGTAGTGGG - Intergenic
932341160 2:70963328-70963350 GGGGAGCTCTGGAGGGTAGTGGG - Intronic
932369344 2:71174567-71174589 GTGGAGAGCTGCAGAGGGGAAGG + Intergenic
933676855 2:85064858-85064880 GTGGAGATGTGCAGGGTTGCTGG - Intergenic
934048323 2:88190138-88190160 GTGGTGGTCTGAAGGCTAGATGG + Intergenic
934922387 2:98356084-98356106 CTTGAGAACTGCAGGGTAGAAGG - Intronic
940067468 2:149646241-149646263 TTAGAAATCTGTAGGGTAGAGGG - Intergenic
941683908 2:168428248-168428270 ATGGAGATTTGCAGGGTAAGGGG + Intergenic
943564212 2:189498394-189498416 GTGCAGACATGCAGGCTAGAGGG + Intergenic
944572543 2:201059171-201059193 CCCGAGATCTGCAGGGTAGTTGG - Intronic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947367099 2:229407779-229407801 TTGAAGAACTGCAGGGGAGAGGG + Intronic
947397250 2:229698293-229698315 ATGGAGACCAGCAGGGTACAAGG - Intronic
1169015969 20:2293014-2293036 GAGGAGCTGTGGAGGGTAGAAGG + Intergenic
1171190864 20:23158481-23158503 GTGCAAGTCAGCAGGGTAGAAGG - Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172241065 20:33412756-33412778 CTGGAGATCTGCTCGGCAGATGG - Exonic
1172390922 20:34564825-34564847 GTGGAAATCTGGAGGATAAAGGG + Intronic
1174658403 20:52191084-52191106 GTGGAGATCTGAATGGAAAACGG - Intronic
1175175277 20:57108108-57108130 GTGGAGATCGGCTAGGAAGAGGG + Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175581377 20:60102406-60102428 CTGGAGACCTTCAGGGTAGCAGG + Intergenic
1175593678 20:60213542-60213564 GTGGAGATGGGAAGGGCAGATGG - Intergenic
1176767999 21:13038613-13038635 GGGGAGCCCTGCAGGGCAGAGGG + Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1181163729 22:20972694-20972716 CAGGAGAACTGCAGGGTCGAAGG + Intronic
1181668967 22:24416928-24416950 GTGCAGAGCTGCAAGGGAGAGGG + Exonic
1181764297 22:25080112-25080134 TAGGAAAACTGCAGGGTAGAGGG + Intronic
1183672271 22:39280078-39280100 GTGGGGATTTGCAGGGTGGTTGG - Intergenic
1184607252 22:45581272-45581294 GTGGTGATCTGGAGGCTGGAGGG - Intronic
1184755948 22:46515799-46515821 CTGGAGATCTGCAGGATGGGCGG - Intronic
951707475 3:25557855-25557877 TTGGAGCTCTGCAGGGAATAGGG - Intronic
951758478 3:26118296-26118318 GGGGAGAGGTGCTGGGTAGAGGG - Intergenic
953023916 3:39134043-39134065 CTGGAGAACTGCATGGGAGAAGG + Intronic
953032751 3:39188870-39188892 GCGGAGATGTGCAGGGTACCAGG - Exonic
953137941 3:40199686-40199708 GTGGAGAATTGAAGGGCAGAGGG - Intronic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
959822607 3:110754460-110754482 GTGGAGGTCTGAAGGAGAGAGGG + Intergenic
960090173 3:113630767-113630789 GTGGAGGTGTGCAGGGTACCAGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
962409934 3:135132309-135132331 GTGTAGAACTCAAGGGTAGAAGG - Intronic
966351462 3:179036572-179036594 GAGGTGAACCGCAGGGTAGATGG + Intronic
966684504 3:182679325-182679347 GTGGAGATGTGTGGGGGAGATGG - Intergenic
971236076 4:24843650-24843672 GTGTTGATCTCCAGGGTAGGAGG - Intronic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
974384479 4:61187158-61187180 GCTGAGATATGCAGGGTTGAGGG - Intergenic
975630969 4:76401887-76401909 GTGGAGGTGGGCAGGGGAGATGG + Intronic
977169011 4:93737348-93737370 GTGGAGATTTGAGGTGTAGAAGG - Intronic
977233601 4:94480674-94480696 GCAGAGGTCTGAAGGGTAGAAGG - Intronic
981606498 4:146546255-146546277 GTGGAGGTTCCCAGGGTAGAGGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
986387230 5:7246697-7246719 ATGGAGATCAGAAGGGTAGGAGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
990898172 5:60722167-60722189 GTGGAGAGGTGCAGAGTAAAGGG + Intergenic
991141995 5:63255217-63255239 GTTTAGAACTGTAGGGTAGAAGG - Intergenic
991349114 5:65702403-65702425 CAGGAGATTTGAAGGGTAGAAGG - Intronic
994146233 5:96398696-96398718 GTGGAAATGGGCAGGGCAGAGGG + Intronic
995495410 5:112737569-112737591 GGGGAGGTCCGCAGGGCAGAAGG - Intronic
998003389 5:138641694-138641716 GGGGACATCTGCAGGCTGGATGG + Intronic
998524446 5:142829516-142829538 CTAGAGATCTGCAGAGCAGAGGG + Intronic
998901922 5:146864728-146864750 CTGGAGCTTTGCGGGGTAGAAGG + Intronic
998952680 5:147407454-147407476 GTGGAGATGTGCTGGCAAGACGG - Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999618354 5:153449510-153449532 GTGGAGAGAGGCAGGTTAGAAGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001202316 5:169729465-169729487 GAGTAGATCTGCCAGGTAGAGGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002607293 5:180390764-180390786 GTGGACATGTGCAGGATGGATGG - Intergenic
1003801192 6:9669270-9669292 GTGAAGATCTGCAGGAGAGGTGG - Intronic
1004466163 6:15887262-15887284 GTGGAGATATCGGGGGTAGAAGG + Intergenic
1006740049 6:36301542-36301564 GTAGAGATCTGAAGGGTACGTGG - Intronic
1006919641 6:37619040-37619062 GTGGAGTGCTGCAGGGCAGAGGG + Intergenic
1010942401 6:81934130-81934152 GTGGACAGATGAAGGGTAGAGGG - Intergenic
1015791359 6:136967569-136967591 CTGGAGATCTCCAGGCTGGATGG - Intergenic
1016364322 6:143299157-143299179 GTGGTCTTCTCCAGGGTAGATGG + Intronic
1018072828 6:160180903-160180925 AGTGAGATCTGCAGGGTAAATGG - Intronic
1019671009 7:2278298-2278320 CGGCAGATCTGCAGGGGAGATGG + Exonic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1024719032 7:52113819-52113841 GTGAAGATTTGCAGGCTAGGAGG - Intergenic
1026599636 7:71766832-71766854 GTGGATATCTCTAGGATAGAGGG + Intergenic
1026953393 7:74362131-74362153 TTGGAGGGCTGCAGGGGAGATGG - Intronic
1029454020 7:100658307-100658329 GTGGTGAGCTGTAGGGGAGAGGG + Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1033541304 7:142358394-142358416 GGTGAGAGCTGCAGGGAAGATGG - Intergenic
1033544275 7:142385963-142385985 GGCGAGGTCTGCAGGGAAGATGG - Intergenic
1034465131 7:151223542-151223564 ATGGACATCTGCAGTGTGGAGGG - Intronic
1035076265 7:156179503-156179525 CTGGGGATCTGCAGGGTCGCTGG + Intergenic
1039407619 8:37326706-37326728 AAGGGGATCTGCAGGGTAGAGGG - Intergenic
1041362017 8:57064655-57064677 GTGGAGATGTGCAGGTTTGAAGG + Intergenic
1043470752 8:80559965-80559987 TTGGATATATGCTGGGTAGAAGG - Intergenic
1043908746 8:85836291-85836313 GCGGAGTTCTTCAGGGCAGAGGG + Intergenic
1046135273 8:110018336-110018358 GTGGAGCTTTGCTGGGGAGAGGG + Intergenic
1047405991 8:124586321-124586343 GTGCAGATAGGCAGGGAAGATGG - Intronic
1048047510 8:130786755-130786777 TTGGAAATATACAGGGTAGAGGG + Intronic
1048553159 8:135452704-135452726 GTATAGATTTGCAGGGCAGATGG + Intergenic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1053016580 9:34665534-34665556 GTGGAGTTCTGCGGGGGCGAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057517428 9:95734034-95734056 GTGGAGAGGGGAAGGGTAGAAGG - Intergenic
1058437314 9:104974929-104974951 ATTGAGATCTGAAGGGTAAATGG + Intergenic
1059159831 9:112023346-112023368 GTTGAGATATGGAGGATAGAAGG - Intergenic
1060848290 9:126854636-126854658 GTGGGGATCTGGAGAGTAGGAGG - Intergenic
1061782014 9:133001763-133001785 GTGGAGATCACCAAGTTAGATGG + Intergenic
1185664908 X:1757915-1757937 GGGGTGGTCTGCAGGGGAGAGGG - Intergenic
1187586749 X:20671361-20671383 GTGGGGAGCAGCAGGGGAGATGG - Intergenic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1189684312 X:43548073-43548095 ATAGAGATCTACAAGGTAGAGGG + Intergenic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192785536 X:74331318-74331340 GTGGAGACATCAAGGGTAGAGGG + Intergenic
1193817819 X:86125430-86125452 TTGGAGATTTCCAGGGAAGAGGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1197005270 X:121488949-121488971 GAGGAAATCTGCAGGGATGAAGG + Intergenic
1200337289 X:155363649-155363671 GAGGACATGTTCAGGGTAGAGGG + Intergenic
1200349181 X:155477578-155477600 GAGGACATGTTCAGGGTAGAGGG - Intergenic