ID: 953403895

View in Genome Browser
Species Human (GRCh38)
Location 3:42650870-42650892
Sequence GGTCCTAGGTGACCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953403895_953403899 3 Left 953403895 3:42650870-42650892 CCAGCCTCTGGTCACCTAGGACC 0: 1
1: 0
2: 1
3: 14
4: 171
Right 953403899 3:42650896-42650918 AGCAACTAAAATCTCCCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 186
953403895_953403900 8 Left 953403895 3:42650870-42650892 CCAGCCTCTGGTCACCTAGGACC 0: 1
1: 0
2: 1
3: 14
4: 171
Right 953403900 3:42650901-42650923 CTAAAATCTCCCATCAGGCCAGG 0: 1
1: 0
2: 2
3: 32
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953403895 Original CRISPR GGTCCTAGGTGACCAGAGGC TGG (reversed) Intergenic
900110390 1:1003036-1003058 GGTCCTTGCTGAGCAGAGGCAGG + Intergenic
900209073 1:1444651-1444673 GGTCCTGGGTGCCCTGGGGCTGG + Intergenic
900218908 1:1496569-1496591 GGTCCTGGGTGCCCTGGGGCTGG + Intronic
900372299 1:2337391-2337413 GGTCCTCGGGCATCAGAGGCGGG + Intronic
901713308 1:11133065-11133087 GGTACAAGGTGATCAGAAGCAGG - Exonic
903005419 1:20295052-20295074 GATCCTAGGGGCCCAGAGGAGGG + Intronic
903822013 1:26110791-26110813 GGTCCTAAGTGACCCCGGGCTGG + Intergenic
904489102 1:30847403-30847425 TGTGCTGGGTGACCTGAGGCAGG + Intergenic
905421264 1:37846882-37846904 TGTGCTAGGTGCCCAGAAGCAGG - Intronic
905988032 1:42305690-42305712 GATCGTTGGTTACCAGAGGCTGG + Intronic
906210045 1:44007715-44007737 TGTCCCAGATGAGCAGAGGCTGG - Intronic
906676497 1:47697418-47697440 GATTCTAGCTGACCAGGGGCCGG + Intergenic
915722928 1:157997006-157997028 GGTCCTAGGGGGGCAGAGGTGGG - Intronic
919743301 1:200993311-200993333 TGCCCAAGGTGACCAGAGGAAGG - Intronic
920275874 1:204803786-204803808 GGTGCTAGGAGAACAGAGGGTGG - Intergenic
921898778 1:220428562-220428584 GCCCCAAGGTGACCTGAGGCAGG - Intergenic
922566906 1:226606983-226607005 GCTGCAAGGTGAGCAGAGGCAGG + Exonic
1065969078 10:30791575-30791597 GGATCTAGATGTCCAGAGGCAGG - Intergenic
1067704004 10:48593587-48593609 GCTACTAAGTGACCACAGGCAGG + Intronic
1067714384 10:48678064-48678086 GGTCCTGTGGGACCAGAGGGAGG - Intergenic
1070932618 10:80272034-80272056 CTTCCTAGGTGACCAGGAGCCGG + Exonic
1071137573 10:82469642-82469664 GCTCCTAGGTACTCAGAGGCTGG - Intronic
1072196127 10:93118593-93118615 GGTCCTTGGTGGGCAGAGGTGGG + Intergenic
1072361477 10:94663783-94663805 GGTCCAAGGTGACTAGGGTCTGG - Intergenic
1074780310 10:116797701-116797723 GGTGGAAGGTGACCAGAGGATGG + Intergenic
1074884406 10:117683402-117683424 GGTCCGGGGTGACAAGAGGATGG - Intergenic
1077299398 11:1840162-1840184 GGTGCTGGGAGGCCAGAGGCTGG - Intronic
1077535444 11:3121963-3121985 TGTCCTGGGTGGCCGGAGGCCGG + Intronic
1077635646 11:3840215-3840237 GTTCCTAGCTGACCAGAGCCTGG - Intronic
1078433299 11:11303899-11303921 TGTGCTAGATTACCAGAGGCAGG - Intronic
1078744362 11:14097048-14097070 GGTCCTAGGTGAGCAATGGAAGG - Intronic
1082065904 11:47900081-47900103 GGTACTGGGTGAGTAGAGGCTGG + Intergenic
1083323468 11:61861743-61861765 GGTCCTAGGTGATCAGGGGTCGG - Intronic
1084622302 11:70281302-70281324 GGGCCTGGGTGACCAGAGGCTGG + Intronic
1085692093 11:78672192-78672214 GCTGCTGGGTGACCAGAGGCTGG + Exonic
1088917552 11:114239000-114239022 TGTGCTAGGTGACCAGGGGCAGG - Intronic
1089702886 11:120255867-120255889 AGTCCAAGGTCACCAGAGGGAGG - Intronic
1090401901 11:126454359-126454381 GACCCCAGGTGACCAGAGCCTGG + Intronic
1091145314 11:133274399-133274421 GGTCCTGGGACAACAGAGGCAGG + Intronic
1091599481 12:1909120-1909142 GGCCCTGTGTGTCCAGAGGCTGG - Intronic
1092408331 12:8235999-8236021 GGTCAGTGGTGGCCAGAGGCCGG + Intergenic
1096402103 12:51315849-51315871 GGTCCTATGAGAACAGAGACTGG - Intronic
1097379185 12:58874879-58874901 GGTCCCAGATGACCAGAACCAGG + Intronic
1100039652 12:90299440-90299462 GGTCATGGATGACCAGAGGAAGG - Intergenic
1102238294 12:111308408-111308430 TGCCCTAGGAGACAAGAGGCAGG - Exonic
1103490679 12:121317059-121317081 GGTGAGAGGTTACCAGAGGCTGG + Intronic
1103751502 12:123166695-123166717 TGTCCTGGGTGTCCAGAGGCTGG + Exonic
1104588289 12:130064542-130064564 GGTCCAGGGTGACCACAGCCTGG + Intergenic
1106220046 13:27739022-27739044 GGTCTTAAGATACCAGAGGCTGG + Intergenic
1106906636 13:34416228-34416250 GCTCCCAGGTAACCAGAAGCAGG + Intergenic
1111243675 13:85508072-85508094 GGGCCAAGGTGGCAAGAGGCTGG - Intergenic
1114992052 14:28299309-28299331 GAGCCCAGGTGACCAGGGGCTGG - Intergenic
1115027683 14:28763100-28763122 GGCCCGAGGTGGACAGAGGCAGG + Intergenic
1115493501 14:33981169-33981191 GGGCCCAGGTGACCTGAGGTGGG + Intronic
1118753363 14:68821979-68822001 GGGGCAAGGAGACCAGAGGCAGG + Intergenic
1125186904 15:36941235-36941257 TTTCCTGGGTGACCTGAGGCTGG - Intronic
1127873010 15:63088876-63088898 GGTCAAAGGAGCCCAGAGGCAGG + Intergenic
1129265513 15:74391314-74391336 GGGGATAGGTGTCCAGAGGCAGG - Intergenic
1129884869 15:79030989-79031011 GGCTCTAGTTAACCAGAGGCAGG - Intronic
1129904641 15:79177876-79177898 GGCACTAGGTGAGCAGAGGAAGG + Intergenic
1132513566 16:355312-355334 GGTAGGAGGAGACCAGAGGCAGG + Intergenic
1132519208 16:379657-379679 GGTTCTAGGTGCCCTCAGGCTGG - Intronic
1134927041 16:18173364-18173386 GATCCTGGGTAACCAGAGTCAGG + Intergenic
1136355778 16:29744327-29744349 GCTCCAAGGTGACCCGTGGCTGG + Exonic
1136368598 16:29821484-29821506 GGTTCTGGGGGAGCAGAGGCTGG + Intronic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1138116456 16:54364355-54364377 GGTCCTGAGTGATCACAGGCCGG - Intergenic
1138443937 16:57051550-57051572 GTTCCTGAGTGACCAGAGCCTGG + Exonic
1142213804 16:88821260-88821282 GGCCCCAGGTGAGCCGAGGCTGG + Intronic
1144771250 17:17760786-17760808 GGTCCTAGCTGCCCAGGGCCAGG + Intronic
1148123939 17:45227382-45227404 GGTCTTAGGTGAGCAGATGCTGG + Intronic
1149815492 17:59719251-59719273 GGTCACAGGTCACCACAGGCTGG - Intronic
1151215022 17:72571466-72571488 GGTCCATGGTGACCAGGGGAAGG + Intergenic
1151363047 17:73600131-73600153 GGTCCCAGGTGGCCTGAGCCCGG + Intronic
1154311077 18:13266486-13266508 GGGCTCAGGTGTCCAGAGGCGGG + Intronic
1156502491 18:37568299-37568321 TGTCCTAGGGGACCAGAAGGAGG - Intergenic
1160952785 19:1675604-1675626 GGTCTTGGGGGGCCAGAGGCGGG + Intergenic
1161575391 19:5051902-5051924 TGTCCAAGGTAAACAGAGGCAGG - Intronic
1161732383 19:5969208-5969230 GGTCCTAAGAGTCCAGAGCCTGG - Intronic
1161988367 19:7669983-7670005 GATCCTAGGGGAGTAGAGGCTGG - Intronic
1163748770 19:19063434-19063456 TGTGCTAGGTGGCCAGAGGGCGG + Intergenic
1164575730 19:29404367-29404389 CGTTCTAGGTGAGCAAAGGCTGG + Intergenic
1165790757 19:38490334-38490356 GGTCCTCAGTGATCAGAGTCAGG - Intronic
1166129719 19:40738896-40738918 GCTCCTAGGTGACTAGTGGGTGG + Intronic
1166930528 19:46298782-46298804 TGTCCTGAGAGACCAGAGGCAGG - Intronic
1168644550 19:58051766-58051788 GGTGCTACGTGCCCAGAGCCTGG - Intronic
925656050 2:6150784-6150806 GGTCCTAGGTGGGCTGAGGAGGG - Intergenic
925894513 2:8461039-8461061 GTTCCTTTGTGACCAGAGACAGG + Intergenic
926795603 2:16616502-16616524 GGTCTTAGGATTCCAGAGGCAGG - Intronic
927192670 2:20527524-20527546 AATCCTAGGTAACCAGAGACAGG - Intergenic
929924330 2:46196394-46196416 GGTCCTAGGTGATCCCTGGCCGG + Intergenic
929983517 2:46702355-46702377 GGTCCAAGGTAAGCAGAGGAAGG - Intronic
930922879 2:56778048-56778070 GGTTATTGGTTACCAGAGGCTGG + Intergenic
933761089 2:85672637-85672659 GGTCAGAGGTTACCAGGGGCTGG + Intergenic
934179458 2:89607330-89607352 GGAGCTATGTGACCACAGGCTGG + Intergenic
937907910 2:127061259-127061281 GGGCCATGGTGACCTGAGGCTGG - Intronic
938388331 2:130883588-130883610 GGACCTGGGAAACCAGAGGCAGG + Intronic
940301952 2:152184722-152184744 CGTCCTTGGGGACCAGTGGCTGG - Intergenic
940552803 2:155183071-155183093 GGTGCTCGTTGACCAGAGACTGG - Intergenic
944083608 2:195818741-195818763 GTTCATTGGTGACCAGAGCCAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946329055 2:218999634-218999656 GGGCTCAGGGGACCAGAGGCGGG - Intergenic
946432180 2:219631754-219631776 GGTCCCAGGTGACCATGGGGAGG + Intronic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947464093 2:230326088-230326110 GGCCCAAGGTGAGCAGAGGGTGG - Intergenic
947472996 2:230415123-230415145 GGCCCAAGGTGAGCAGAGGGTGG - Intergenic
947571683 2:231240760-231240782 GACCCTAGATGACCAGAGGACGG - Intronic
948270794 2:236671853-236671875 GCTCCTGGGTGACCTGAGGATGG + Intergenic
948291245 2:236826518-236826540 GATCCTATATGACCAGAGTCAGG + Intergenic
948735234 2:239999367-239999389 GGTGCTCTGTGCCCAGAGGCTGG + Intronic
948979163 2:241484066-241484088 GGTCGTTTTTGACCAGAGGCAGG - Intronic
1171354685 20:24534696-24534718 GGACCTAGGTGACCACCAGCAGG - Intronic
1174789478 20:53464191-53464213 GGTTCTAGGAGAGCAGAGGTGGG - Intronic
1175221589 20:57420525-57420547 GGTTGGAGGTGACCAGGGGCAGG + Intergenic
1175259093 20:57663703-57663725 GGGTATAGGTGAGCAGAGGCCGG + Intronic
1179062315 21:37990303-37990325 GGTCCTAGGTCACAGGGGGCCGG - Intronic
1182371512 22:29814584-29814606 GGGCCTAGCTACCCAGAGGCTGG - Intronic
1183062833 22:35346331-35346353 GGGCCTTGGTGCCCAGAGACGGG - Intronic
1183361699 22:37386324-37386346 AGTCCTAGGTGAGCAGAGTGAGG - Intronic
951649454 3:24934171-24934193 GGTCCTAGCTAGCCAGAGGAGGG + Intergenic
953403895 3:42650870-42650892 GGTCCTAGGTGACCAGAGGCTGG - Intergenic
957981491 3:87517087-87517109 TGTCCAAGGTTACCAGAAGCTGG - Intergenic
958675638 3:97265421-97265443 GGTCCGAGGTGGCAAGGGGCTGG + Intronic
961786400 3:129349727-129349749 GGTTCTAGGTGAGCTGGGGCGGG + Intergenic
962968338 3:140374996-140375018 GCTCCTAGGTGAGCAAAGGAAGG - Intronic
966178981 3:177170714-177170736 GGTACTTGGTGGGCAGAGGCAGG - Intronic
968518984 4:1027287-1027309 GGTCAGAGGTGACCTGAGCCTGG - Intergenic
976390114 4:84498024-84498046 GGTTGTGGGTGCCCAGAGGCGGG + Exonic
977621448 4:99142252-99142274 GGTCCTGGGTATCCAGAGGAAGG - Intronic
977802777 4:101257953-101257975 TGTCCTACTTGTCCAGAGGCAGG + Intronic
981012825 4:139943347-139943369 GGTCACAAGTGGCCAGAGGCTGG + Intronic
984827784 4:183942739-183942761 GGTCCTAGGAGAATGGAGGCAGG + Intronic
986162879 5:5247260-5247282 GCTCAAAGGTGACCAAAGGCAGG - Intronic
986357519 5:6943252-6943274 GGTCCTCTGGGAACAGAGGCAGG - Intergenic
987033117 5:13994041-13994063 GGTCAGAGGTGAGCAGAGGACGG - Intergenic
990929244 5:61069144-61069166 GGTCCTAGATTTCCAGAGTCAGG - Intronic
993566252 5:89479306-89479328 GCTCCCCGGTGACCAGAGACAGG + Intergenic
995271148 5:110220626-110220648 AGTCCAAGGTGACCAGAGACTGG - Intergenic
997363739 5:133312169-133312191 GGTCCAATGTGAAGAGAGGCAGG - Intronic
997657798 5:135568278-135568300 GGTCCCAGGACAACAGAGGCTGG - Intergenic
999302882 5:150501987-150502009 GGGCATGGGTGGCCAGAGGCAGG + Intronic
1000042162 5:157492943-157492965 GCTCCTAGGTGAGCAGGGGAGGG + Intronic
1002425461 5:179172122-179172144 GGACATAGGTGAACTGAGGCTGG - Intronic
1003030563 6:2597090-2597112 GGGGCTCAGTGACCAGAGGCAGG - Intergenic
1003568398 6:7239782-7239804 GGTCCTAGGTGGCAACAGTCAGG - Intronic
1007166631 6:39832940-39832962 GGGCCCAGGTGTCCAGTGGCTGG + Intronic
1008211372 6:48729121-48729143 ACTCCAAGGTGACCAGGGGCTGG + Intergenic
1008878141 6:56351682-56351704 AATCCTGGGTGGCCAGAGGCAGG + Intronic
1013990425 6:116248703-116248725 CTTCTTAGGTGACCAGAGGATGG + Exonic
1015663654 6:135603447-135603469 GGGCTAAGGTGACCAGGGGCTGG - Intergenic
1017687104 6:156924502-156924524 GCTCCTAAGTGACCAGTGGATGG + Intronic
1021333360 7:19367423-19367445 GGTACTTGGAGACCTGAGGCAGG - Intergenic
1023573058 7:41592452-41592474 GAACCTAGGAGACCAGAGGAAGG - Intergenic
1023635266 7:42203404-42203426 GGTAGTAGGTAACCAGAGGATGG - Intronic
1023876768 7:44290471-44290493 GGACGTAGGTGGCCTGAGGCTGG - Intronic
1024794797 7:53007986-53008008 GGTCCTGGGTGAAAAGAGGCAGG + Intergenic
1028053147 7:86208983-86209005 GGGCCAAGGTGGCAAGAGGCTGG + Intergenic
1028764694 7:94539969-94539991 GGTACTAGGTGATCAAAGGAAGG - Intronic
1029464505 7:100716764-100716786 GGTCCTGGGAGAGCAGAGGCTGG + Intergenic
1032388902 7:131543018-131543040 GGTGCTCTGTGACCAGAGGCTGG + Intronic
1033012980 7:137642299-137642321 GGCTCTAGGTCACCACAGGCTGG + Intronic
1033220442 7:139523805-139523827 GGTCCTAGCCCACCCGAGGCCGG + Intergenic
1034423644 7:151001774-151001796 TGTCCTGGGTGCACAGAGGCAGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1037377343 8:18245102-18245124 GGTCCTAGGGAAGCTGAGGCAGG + Intergenic
1037817818 8:22121015-22121037 GGAGCCAGGGGACCAGAGGCTGG - Intronic
1046017347 8:108620994-108621016 GGTCCTTGGTGATCAGATGTAGG + Intronic
1046115439 8:109778459-109778481 AGTTCTTGGTGACCAGAGGTAGG - Intergenic
1047272812 8:123378588-123378610 GTTACTAGGTGAGCTGAGGCAGG + Intronic
1049236736 8:141515881-141515903 GTTGCTAGGTGAGGAGAGGCTGG - Intronic
1049238616 8:141525321-141525343 AGTCCGAGGTGCCCAGGGGCAGG + Intergenic
1049610686 8:143553451-143553473 GGTCCTGGGGGGCCAGAGCCTGG - Exonic
1051941437 9:22510122-22510144 GGAGATAGGTTACCAGAGGCTGG + Intergenic
1053358306 9:37465363-37465385 GGAGCTAGGGGACTAGAGGCGGG - Exonic
1056252564 9:84765034-84765056 AGTAGAAGGTGACCAGAGGCTGG + Intronic
1058194536 9:101956540-101956562 GATCTAAGGTGACCAAAGGCAGG - Intergenic
1058247922 9:102654079-102654101 GGTTCTGGGTGACCACTGGCTGG + Intergenic
1058535066 9:105950349-105950371 AGTCTGAGGTGACTAGAGGCTGG - Intergenic
1062116779 9:134813864-134813886 GGTCCTGGGTGCCCAGGGGCAGG + Intronic
1062401703 9:136375669-136375691 GGTCCGCAGTGAACAGAGGCGGG - Exonic
1062648611 9:137564066-137564088 AGTCCCAGCTGACCACAGGCAGG + Intronic
1185672986 X:1826494-1826516 GGTCCCAGGTGAGGTGAGGCTGG - Intergenic
1185681858 X:1895099-1895121 ATTGCTAAGTGACCAGAGGCTGG + Intergenic
1191094686 X:56661750-56661772 AGTCCTAGGTCACTAGGGGCTGG - Intergenic
1195565079 X:106331235-106331257 AGTCGTAGGTGACCAGAGTACGG + Intergenic
1199182948 X:144879407-144879429 GGTCCATGGTGACCAGGGGCTGG + Intergenic