ID: 953407488

View in Genome Browser
Species Human (GRCh38)
Location 3:42666651-42666673
Sequence GGCCCCACTACAGCCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953407485_953407488 7 Left 953407485 3:42666621-42666643 CCACAGGCACTGGTGGTGTCATC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 123
953407484_953407488 8 Left 953407484 3:42666620-42666642 CCCACAGGCACTGGTGGTGTCAT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 123
953407481_953407488 17 Left 953407481 3:42666611-42666633 CCAGGATCTCCCACAGGCACTGG 0: 1
1: 0
2: 2
3: 25
4: 323
Right 953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 123
953407479_953407488 29 Left 953407479 3:42666599-42666621 CCATCACTGGCACCAGGATCTCC 0: 1
1: 0
2: 2
3: 32
4: 273
Right 953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 123
953407478_953407488 30 Left 953407478 3:42666598-42666620 CCCATCACTGGCACCAGGATCTC 0: 1
1: 0
2: 0
3: 18
4: 158
Right 953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953407488 Original CRISPR GGCCCCACTACAGCCTGAGT AGG Intergenic
900299719 1:1970523-1970545 TGCCCCACAGCCGCCTGAGTGGG + Intronic
901203865 1:7482997-7483019 GCCACCTCTACAGCCTGAGAGGG + Intronic
902205275 1:14863909-14863931 TGCAGAACTACAGCCTGAGTTGG + Intronic
905447927 1:38039291-38039313 GGCCCCACTTCACCCACAGTGGG - Intergenic
906249673 1:44301411-44301433 GCCCTGACTACAGCCTCAGTTGG + Intronic
907272037 1:53296819-53296841 GGACCCGCCACAGCCTGAGAGGG - Intronic
907273638 1:53304984-53305006 GGTCCCACTACAGCTTGAAGAGG + Intronic
911275391 1:95853103-95853125 TGCCCCCCTGCAGCCTGAGGAGG - Intergenic
912485215 1:110021564-110021586 GGCCCCTCCCCAGCCTGGGTGGG - Intronic
913978701 1:143488455-143488477 GGACCCACTGCAGCCTGTGAAGG + Intergenic
914073110 1:144314103-144314125 GGACCCACTGCAGCCTGTGAAGG + Intergenic
914106044 1:144652257-144652279 GGACCCACTGCAGCCTGTGAAGG - Intergenic
915307296 1:154987970-154987992 GGCCCCTCAGCAGCCTGAGGTGG + Intronic
921131234 1:212221743-212221765 GGGCCCAGGACAGCCTGAGAAGG - Intergenic
921957371 1:220998552-220998574 GGCACCACTAAAGCCTGATCTGG - Intergenic
923114157 1:230918741-230918763 GGCCCCACATCTGCCTGGGTGGG - Intronic
924386205 1:243499890-243499912 AGCCCCACTGCAGGCTGAGGCGG - Exonic
1066987331 10:42479662-42479684 GGCCTCACTGCAGCCTGGGCTGG + Intergenic
1067431669 10:46249626-46249648 GGCTCCTCTGCAGCCTCAGTGGG - Intergenic
1067441751 10:46312548-46312570 GGCTCCTCTGCAGCCTCAGTGGG + Intronic
1067761224 10:49048529-49048551 GGCCCCACTACAGCCCAAGAAGG - Exonic
1067849115 10:49743868-49743890 GGACCCACTACAGACTGAGCAGG + Intronic
1071003334 10:80855684-80855706 TGCCCCACCACAGCGTGAGGTGG + Intergenic
1071831561 10:89377447-89377469 GGCTCCACTATAGCCAGGGTTGG + Intronic
1075870645 10:125770720-125770742 GGCCCCACTTCAGCCTTACATGG - Intronic
1076385239 10:130050929-130050951 GGTCCCTCCACAGCCTGAGATGG - Intergenic
1080685649 11:34512991-34513013 GGCCCGGCTTCAGCCTGAGGAGG + Intronic
1084604121 11:70162556-70162578 GGCCCCACCGCAGCCTGGGATGG - Intronic
1084898575 11:72293384-72293406 GGCACCACTGCACCCTGAGAAGG - Exonic
1089767360 11:120777554-120777576 GCCCCCACTACAGCCGGGGCAGG - Intronic
1090423335 11:126590651-126590673 GTCCCCATTTCAGCCTCAGTGGG + Intronic
1092194598 12:6541633-6541655 TGCCCCACCACAGCTGGAGTTGG - Exonic
1092913582 12:13169425-13169447 GGCTCCACTACAGGGTCAGTGGG - Intergenic
1095134873 12:38588246-38588268 GGCCCCACTACATCCTGTCTGGG + Intergenic
1097854802 12:64451685-64451707 GGCTCCACTGCAGCCAAAGTGGG + Intergenic
1099995219 12:89770826-89770848 GGCCCAACAACAGTCAGAGTAGG - Intergenic
1104509134 12:129360319-129360341 GGCCCTTCTCCAGCCTGGGTGGG + Intronic
1105220628 13:18322941-18322963 GGACCCACTGCAGCCTGTGAAGG - Intergenic
1107419299 13:40231928-40231950 GTCCCTACCACATCCTGAGTGGG + Intergenic
1111644589 13:91015345-91015367 GTCCCAACTACAGGCTGAGGTGG + Intergenic
1114618851 14:24082730-24082752 GGCCCCCCTACAGCCTCACTGGG - Exonic
1118365010 14:65087255-65087277 GGCCCCAGTAGAGACTGTGTGGG - Intronic
1119780718 14:77275329-77275351 GGCCCCAGTGCAGCCTAATTGGG + Exonic
1121419755 14:93804827-93804849 GGCCCCACTCCAGCCTCACGGGG + Intergenic
1126696345 15:51329302-51329324 GGCCCCACTCCAGACTCAGCAGG + Intronic
1131851659 15:96550205-96550227 GGTCCCAATACTGCCTGAATGGG + Intergenic
1131871075 15:96765126-96765148 GGCCTGAGGACAGCCTGAGTCGG + Intergenic
1133345253 16:5065581-5065603 GGCCCCAGTATAGCCTGCCTCGG - Intronic
1137513871 16:49125566-49125588 GTCCCAACTACAGCCTGTGTGGG + Intergenic
1139355250 16:66363777-66363799 GGCCCCACTCCAGGCTGATGGGG - Intergenic
1141151481 16:81567428-81567450 GGCCCAAATACTGCCTGACTTGG - Intronic
1141855831 16:86681083-86681105 AGCCCCTCTGCAGCCTGGGTGGG + Intergenic
1142271370 16:89091303-89091325 AGCCCCATTAAAACCTGAGTGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145989855 17:29072789-29072811 GGCCACACTACAGAATGAGAAGG + Intergenic
1146556104 17:33825464-33825486 GGCCCCTTTACACCCTGAGCAGG + Intronic
1147249615 17:39145202-39145224 GGCCCAATGGCAGCCTGAGTAGG - Intronic
1147310769 17:39595092-39595114 GGCCCCACCCAAGCCTGTGTGGG + Intergenic
1147747252 17:42702394-42702416 GGCCTCACTACAGAGGGAGTGGG + Exonic
1152585478 17:81187701-81187723 GGCCTCACCAAAGCCTGTGTGGG - Intergenic
1153085741 18:1284826-1284848 GGCCCACCTCCAGCCTCAGTGGG - Intergenic
1153682808 18:7516424-7516446 GGCCCCACTACTTCCTGAACGGG - Intergenic
1158624471 18:59059298-59059320 GGCCCCACCTCAGCCAAAGTTGG - Intergenic
1160681101 19:412036-412058 GACCCCACCACAGCCTGGCTTGG + Intergenic
1161016875 19:1987574-1987596 GGCCCCGCTGCTGCCTGCGTGGG - Exonic
1162016922 19:7851129-7851151 GTCCTCACGACAGCCTGAGAGGG - Intronic
1165961683 19:39539956-39539978 GGCCCCGGCACAGCCTGAGGAGG - Exonic
1167377252 19:49118847-49118869 GGCCGCACTACTGTCTGCGTGGG + Exonic
1167605371 19:50479057-50479079 GGCCCCACCTCACCCGGAGTCGG - Exonic
925187187 2:1856605-1856627 GGCTACAATACAGCCTCAGTCGG - Intronic
927233550 2:20849171-20849193 GGCCCCTCTACAGGCTGCTTGGG + Intergenic
929939436 2:46321698-46321720 ACCCCCACAACAGCCTGTGTGGG + Intronic
932192764 2:69754801-69754823 GGCCCCAGGACAGCCTTAGGAGG - Intronic
934183426 2:89649534-89649556 GGACCCACTGCAGCCTGTGAAGG + Intergenic
934293709 2:91723706-91723728 GGACCCACTGCAGCCTGTGAAGG + Intergenic
934620358 2:95799731-95799753 CGCCCCACTCCAGCCAGTGTGGG + Intergenic
934640533 2:96024834-96024856 CGCCCCACTCCAGCCAGTGTAGG - Exonic
1171458169 20:25283381-25283403 GTCCCCACTAAAGCCCCAGTGGG - Intronic
1172034528 20:32001819-32001841 GGCCCCACCACAGCTTGAACTGG - Exonic
1173901871 20:46596213-46596235 GCCCCCAATACTGGCTGAGTAGG + Exonic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1179730490 21:43364724-43364746 GGCCCCACCACAGTCTGAACCGG - Intergenic
1184187357 22:42873617-42873639 GGGCACACTTCAGCCTGTGTGGG + Intronic
1185092810 22:48785425-48785447 GTCCCCGCAAAAGCCTGAGTTGG + Intronic
950019819 3:9779423-9779445 TGCCACACTACAGCCAGAGAAGG + Intronic
951931612 3:27973705-27973727 GGCCCCACGACAGCATCTGTGGG + Intergenic
952865757 3:37854230-37854252 AGCTCCAATACAGCCTGTGTAGG + Intergenic
953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG + Intergenic
954625554 3:52020178-52020200 AGCCCCACTGCAGCCTGGGGAGG - Intergenic
955076746 3:55621154-55621176 GCCCCCCCTCCAGCCAGAGTTGG + Intronic
957674673 3:83351126-83351148 GGCCCAACAACAACCTGTGTTGG + Intergenic
962281033 3:134052049-134052071 GGGCCCACTCCAGCCTGAGCTGG + Intronic
967956262 3:194880087-194880109 GGCCCGATTCCAGCATGAGTTGG - Intergenic
970591403 4:17563411-17563433 GGCAACACCATAGCCTGAGTAGG - Intergenic
972469447 4:39389640-39389662 CGCACCACTCCAGCCTGGGTTGG - Intergenic
974143564 4:57919147-57919169 GACCCCACCACAGCTTGAGGAGG - Intergenic
998269916 5:140697242-140697264 GGCTCCTCCCCAGCCTGAGTTGG - Exonic
998729417 5:145057544-145057566 GGTTCCACTTCAGCCTGAGAGGG + Intergenic
1001437998 5:171715388-171715410 AGCCACACTACAGCCTGAAAGGG + Intergenic
1002565413 5:180110504-180110526 GGCCCCACATCACCCTGAGAGGG - Intronic
1002616829 5:180461350-180461372 GGCCTCTCTCCAGCCTGGGTGGG - Intergenic
1005163838 6:22896566-22896588 GTTCTCAATACAGCCTGAGTGGG - Intergenic
1014373809 6:120646200-120646222 GACCCTCCTACAGCCTCAGTGGG + Intergenic
1014977102 6:127901048-127901070 TGTCACACTACAGCCAGAGTGGG + Exonic
1024695970 7:51857124-51857146 GGCCTCAGTACAACCTAAGTGGG + Intergenic
1029507892 7:100973431-100973453 GCCCCTACTACAGGCTGAGGAGG + Intronic
1029548305 7:101222834-101222856 GGTCCTCCCACAGCCTGAGTTGG - Intronic
1029611296 7:101627888-101627910 GGCCACACTGCAGTCTGAGTGGG - Intronic
1032598058 7:133262251-133262273 GTCCCAACTACAGGCTGAGGTGG + Intronic
1032683937 7:134211311-134211333 GGCCCTGCTTCAGCCAGAGTTGG - Intronic
1034821344 7:154219302-154219324 ACTCCCACTACTGCCTGAGTAGG - Intronic
1034826799 7:154272707-154272729 GGCCTCAATAGAGCCTGAGATGG + Intronic
1035671116 8:1417693-1417715 GGCCCCACTCCTGCCTCACTCGG + Intergenic
1037556133 8:20024564-20024586 CACCGCACTACAGCCTGGGTGGG - Intergenic
1038967279 8:32588496-32588518 GGTGCCACTACAGCCAGAGTTGG - Intronic
1039947329 8:42140895-42140917 GGCCCCATTCCAGGCTGGGTCGG + Intergenic
1040320249 8:46290781-46290803 GGCCCCACCACTGCCTGTGGGGG + Intergenic
1040323044 8:46328115-46328137 GGCCCCACCACCGCCTGTGAAGG + Intergenic
1041053284 8:53957699-53957721 GGCCCCACCCCAGACTCAGTAGG - Intronic
1047731887 8:127735281-127735303 GGCCCCACGGAAGCCTGAGCAGG + Intergenic
1048150985 8:131893902-131893924 GGCACCACTACAGCCAGGCTTGG - Intergenic
1048235276 8:132683614-132683636 GGCCCCTACACAGCCTCAGTGGG + Intergenic
1048460827 8:134620360-134620382 GGCCCCACTCCAGCCCGAGAAGG + Intronic
1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG + Intronic
1050175084 9:2861635-2861657 AGCCCCACTCCAGGCTGACTGGG - Intergenic
1052038586 9:23711641-23711663 CTCTCCACTACAGTCTGAGTTGG + Intronic
1052827361 9:33186778-33186800 GGCCAAACTACAGCCTCAGCTGG - Intergenic
1061212146 9:129199953-129199975 GGCCCCTCTACCCCATGAGTCGG - Intergenic
1186467567 X:9795896-9795918 GGAACCACTACAGCCAAAGTTGG - Intronic
1191885742 X:65886122-65886144 GACATCAGTACAGCCTGAGTTGG - Intergenic
1193444538 X:81584030-81584052 GACCCAACTTCAGTCTGAGTGGG - Intergenic
1193477287 X:81982161-81982183 GACCCCACTGTAGCCTGACTGGG + Intergenic
1196704489 X:118705079-118705101 GGCCCCACTGTAAACTGAGTAGG - Intergenic