ID: 953407633

View in Genome Browser
Species Human (GRCh38)
Location 3:42667298-42667320
Sequence CCTTGGGGCTCTCTGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 382}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953407619_953407633 8 Left 953407619 3:42667267-42667289 CCTGGAGTCTGGGTCTGCCCCCT 0: 1
1: 0
2: 1
3: 25
4: 280
Right 953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 382
953407625_953407633 -10 Left 953407625 3:42667285-42667307 CCCCTCCCCGGCTCCTTGGGGCT 0: 1
1: 0
2: 3
3: 28
4: 345
Right 953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 382
953407615_953407633 29 Left 953407615 3:42667246-42667268 CCTGTTTGGCTAGAACTCAGGCC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 382
953407624_953407633 -9 Left 953407624 3:42667284-42667306 CCCCCTCCCCGGCTCCTTGGGGC 0: 1
1: 0
2: 3
3: 46
4: 427
Right 953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953407633 Original CRISPR CCTTGGGGCTCTCTGGTCTC AGG Intergenic
900711478 1:4117339-4117361 ACCTGGGGCTCACTGTTCTCAGG - Intergenic
900982663 1:6055304-6055326 CCTTGGGGATCTCGCTTCTCAGG + Intronic
901167069 1:7228828-7228850 CCTTGGGGCACTTTGGACTAAGG + Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901509572 1:9710042-9710064 CCTTCGGCCTCTCAGGTCTCAGG + Intronic
902209375 1:14893687-14893709 CTTTGTGGCTTTCTGGCCTCAGG - Intronic
902601064 1:17540320-17540342 CCTTGGGGGTCCCTGGGATCGGG + Intronic
904684929 1:32252924-32252946 CCTGTGGGCTCTCTGGCCTTTGG - Intronic
905563468 1:38945132-38945154 CCTTGGGGCACCTTGGCCTCTGG - Intergenic
906051727 1:42880190-42880212 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
906180017 1:43810199-43810221 CCTTGGGGCTCTTGGATCTGTGG - Intronic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
909013582 1:70359940-70359962 CCTTGGAGCTCTCTGAGCACTGG + Intronic
909197719 1:72648632-72648654 CCTTGGTGCCCTCTGGACTTTGG + Intergenic
910176462 1:84436096-84436118 CCTTCAGCCTCTCTGTTCTCTGG - Intergenic
911104637 1:94120147-94120169 TCTTGGTGTTCTCTGATCTCCGG + Intronic
911288615 1:96028381-96028403 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
911564964 1:99453341-99453363 CTTTGGAGTTCACTGGTCTCAGG + Intergenic
913477761 1:119255235-119255257 GCTTGGAGCTCTCAGGCCTCAGG + Intergenic
918983589 1:191595527-191595549 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
919513338 1:198493591-198493613 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
920971038 1:210743985-210744007 CCTTAGGGCTCTCCGGTGCCAGG + Intronic
922697549 1:227738894-227738916 CCTAGGGGCTCAGTGATCTCAGG - Intronic
923180099 1:231509195-231509217 CCCTGGGGCTCTCTGCCCTGAGG + Intergenic
924950056 1:248873905-248873927 CCTGCGGGCTTTCTGGTCTCCGG + Intergenic
1063301580 10:4854036-4854058 CCTTGGGGCTGTTTTGTCTATGG + Intergenic
1064052294 10:12069145-12069167 CCCTGGGGCTCGCGGCTCTCGGG - Exonic
1064382515 10:14859051-14859073 CCCTGAAGCTCTCTGCTCTCAGG - Intronic
1065765196 10:29022880-29022902 CCTAGGGGTTCTCTGGTCAGTGG + Intergenic
1065806202 10:29395450-29395472 CTTTGGTGCTCTGTGGTTTCTGG + Intergenic
1066188962 10:33037707-33037729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1067210555 10:44257477-44257499 TCATGTGGCTCTCTGGTCTGAGG - Intergenic
1068760766 10:60706341-60706363 CCTTGGGGCTGGCATGTCTCTGG - Intronic
1069121905 10:64577507-64577529 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1069776617 10:70930992-70931014 CCTTGGGTCTCTCTTCCCTCTGG - Intergenic
1070201096 10:74207237-74207259 CTTTGGGGCTCTGTGGTTTCTGG - Intronic
1070401300 10:76055826-76055848 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1070604677 10:77890409-77890431 CCTTGGGTCTCTAGGGTCCCAGG + Intronic
1070617616 10:77981103-77981125 CCATGGGACTCTCTGGGCTTTGG + Intronic
1071404866 10:85320093-85320115 CCCTGGGGCTCTGCTGTCTCAGG - Intergenic
1071819259 10:89264026-89264048 CTTTGGGGCACTGTGGTTTCTGG - Intronic
1075777214 10:124996724-124996746 CCTGGGGCCTCGGTGGTCTCTGG - Intronic
1076249960 10:128977831-128977853 CCTGGGGACTCTGTGCTCTCCGG - Intergenic
1076764797 10:132627219-132627241 CGTTTAGGCTCTCTGGTCTGTGG + Intronic
1076794957 10:132793938-132793960 CCTGGGGCCTCTCGGGTGTCTGG + Intergenic
1076859834 10:133135517-133135539 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1076859986 10:133135921-133135943 CTGTGGGGGTTTCTGGTCTCTGG + Intergenic
1076860135 10:133136325-133136347 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1076860193 10:133136486-133136508 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1076860528 10:133137429-133137451 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1076860945 10:133138565-133138587 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1076861048 10:133138835-133138857 CTGTGGGGGTTTCTGGTCTCTGG + Intergenic
1076861187 10:133139212-133139234 CTGTGGGGGTGTCTGGTCTCTGG + Intergenic
1077823949 11:5783496-5783518 CCTTAGGGCTCTGTGGTCTCTGG - Intronic
1078654752 11:13227978-13228000 CATTGTGGCTCTCTGGTCCTTGG - Intergenic
1079104795 11:17563643-17563665 CCTGGGGGCTATTGGGTCTCAGG + Intronic
1079503857 11:21132661-21132683 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1079997092 11:27305796-27305818 CTTTGGGGCTCTCTGGTTCCTGG + Intergenic
1080333882 11:31174377-31174399 CCTTGGGCCCCTCTGGACTTTGG + Intronic
1081082170 11:38756176-38756198 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1081237114 11:40659250-40659272 CCTTGGTCCTCTCTGGACTTTGG + Intronic
1082661763 11:55920530-55920552 CTTTGGGGCTCTTCGGTTTCTGG + Intergenic
1083603178 11:63961478-63961500 CCATGGGCCTCTCTTGTTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084564611 11:69921908-69921930 CCCTGGGGCTCCCTGGTGGCTGG + Intergenic
1084809791 11:71605222-71605244 TCTAGGCGCTCTCTGGTCCCGGG + Intergenic
1085403839 11:76250120-76250142 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086249426 11:84795771-84795793 CTTTGAGGCTCTATGGTTTCTGG + Intronic
1086268154 11:85027776-85027798 CTTTGGGGCTCTTTGGTTCCTGG - Intronic
1086508213 11:87528098-87528120 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086805869 11:91241268-91241290 CCTGTGGGCCCACTGGTCTCTGG + Intergenic
1090260552 11:125315782-125315804 CATGGGGGCACTGTGGTCTCGGG - Intronic
1090514531 11:127411561-127411583 CCTTGGGGCCCTGTGGTTCCTGG - Intergenic
1091225139 11:133952439-133952461 CCAAGGGTCTCTCTGCTCTCAGG + Intronic
1091237525 11:134032031-134032053 CCTTGGGGCTGCCTTGTTTCAGG + Intergenic
1091673141 12:2467316-2467338 CCATGTGGCCCTCTGGCCTCAGG - Intronic
1092006026 12:5071216-5071238 CCTTGGGCCTGGCTGGTCTATGG - Intergenic
1093182952 12:15988098-15988120 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1095443990 12:42267080-42267102 CTTTGGAGCTCTGTGGTTTCTGG - Intronic
1096295566 12:50381088-50381110 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097078494 12:56412552-56412574 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1097491903 12:60281870-60281892 CCTTGGTGCTCTGTGGTTCCTGG - Intergenic
1098767995 12:74514429-74514451 CCATGGGGCTCTGTGGTTACTGG - Intergenic
1098802901 12:74984973-74984995 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1099560886 12:84173376-84173398 CTTTGAGGCTCTGTGGTTTCTGG - Intergenic
1099738656 12:86601926-86601948 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1102570660 12:113825260-113825282 CCTTGAGGCTCTCAGGTGGCAGG - Intronic
1102793385 12:115667301-115667323 CCTTGGGCCTCTCTGGGCCAAGG - Intergenic
1103144818 12:118586158-118586180 CCTTGCAACTCTCTGTTCTCTGG - Intergenic
1104659473 12:130600354-130600376 TCTTGGGGCTGGCAGGTCTCTGG - Intronic
1106253428 13:28001385-28001407 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1106905774 13:34407566-34407588 CATTGTGGCTCTCTGGCCTTTGG + Intergenic
1106999492 13:35526933-35526955 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1107883184 13:44851603-44851625 CTTTGGGGCTCTCTGATCCAGGG + Intergenic
1108127358 13:47258883-47258905 CCTGTGTCCTCTCTGGTCTCAGG - Intergenic
1108240233 13:48456891-48456913 CTTTGGGGCCCTGTGGTTTCTGG - Intronic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109603539 13:64662983-64663005 CCTTGGCCCTCTCTGGACTTTGG + Intergenic
1109603674 13:64663752-64663774 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1109988201 13:70017307-70017329 CTTTGGGGCTCTATGGTCCATGG + Intronic
1110352514 13:74525901-74525923 GCTTGGGGCTCTCTGTGCTGGGG - Intergenic
1110453226 13:75660674-75660696 GCTTGGGGCTTCATGGTCTCAGG + Intronic
1111002762 13:82206237-82206259 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1111141578 13:84126901-84126923 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111485788 13:88896495-88896517 CCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1111487714 13:88926370-88926392 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111549023 13:89783576-89783598 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1113025750 13:105939021-105939043 GCCTGGGGCTCTCTGGGCACTGG + Intergenic
1113901197 13:113799116-113799138 CCATGGGGCTTTCTGCTGTCTGG + Intronic
1116083303 14:40203909-40203931 CTTTGGGGCTCTCTGTTTCCTGG - Intergenic
1116151189 14:41144792-41144814 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1116779907 14:49225505-49225527 TCTTATGGCTCTGTGGTCTCTGG - Intergenic
1116961748 14:50974004-50974026 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1117558740 14:56913031-56913053 CCCTGTGCCCCTCTGGTCTCAGG + Intergenic
1117742044 14:58828471-58828493 GCTTGAGGCCCTCAGGTCTCTGG - Intergenic
1117999147 14:61506624-61506646 CCCTGGGGCTCTTTATTCTCAGG + Intronic
1119223763 14:72928871-72928893 CCTTGGGGCTCTCCAGTTTGGGG - Intronic
1119862181 14:77944120-77944142 CCTTGGGCCTCTCTGGATGCTGG + Intergenic
1120444675 14:84579315-84579337 CCTTGGGGCTCCGTGGTTGCTGG + Intergenic
1120590129 14:86364726-86364748 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1120946782 14:90005260-90005282 CCTTGGAGCCCTGTGGGCTCTGG + Intronic
1121340232 14:93100627-93100649 CCTTGGGGCATTCTGGCTTCAGG - Intronic
1121368745 14:93337807-93337829 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1121636511 14:95457373-95457395 CCTTTGGGCTGTCTGGGCTGGGG - Intronic
1122202816 14:100132834-100132856 CAGGGAGGCTCTCTGGTCTCAGG + Intronic
1122385999 14:101348711-101348733 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1122579090 14:102760578-102760600 CCTTGGGGCTCTGACTTCTCTGG - Intergenic
1122836318 14:104432654-104432676 CTCTGGGTCTCTCTGGTCCCTGG - Intergenic
1122871886 14:104642532-104642554 CCCTTGGGGCCTCTGGTCTCTGG - Intergenic
1123512807 15:21013533-21013555 CCTTGGGGGTATATGTTCTCGGG + Intergenic
1124031579 15:26017007-26017029 GGTTGCGGCTCTCTGGGCTCTGG - Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1125281365 15:38045278-38045300 CTTTGGGCCTCTTTGCTCTCAGG + Intergenic
1125539030 15:40459196-40459218 CCTTGGGCCACTTTGGCCTCGGG - Exonic
1125689874 15:41587268-41587290 CCTTGGGGCTGTTTTGTCTATGG + Intergenic
1125791413 15:42369179-42369201 TCTTGGGGCTGGCTTGTCTCTGG + Intronic
1125862020 15:43008433-43008455 CCTTGGACCCCTCTGGTCTTTGG + Intronic
1127875225 15:63106192-63106214 CCTTCTGGCTCTCTCCTCTCTGG - Intergenic
1128555729 15:68630463-68630485 GGGTGGGGCTCTGTGGTCTCTGG + Intronic
1131999146 15:98162417-98162439 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1132157249 15:99504257-99504279 CTTTGGGCCTCTCTGCTCTATGG - Intergenic
1132404753 15:101535594-101535616 ACCTGGGCCTCTCGGGTCTCTGG - Intergenic
1132745048 16:1433038-1433060 CCTTGGGGTACCCTGGGCTCCGG - Intergenic
1132799507 16:1744682-1744704 GCTTGACGCTCTCTGGCCTCCGG + Intronic
1134249413 16:12563879-12563901 CCTTGGGCCTCTGCCGTCTCTGG + Intronic
1134683889 16:16145545-16145567 CCTTACGCCTCTCTGGTCTGGGG - Intergenic
1136019726 16:27432414-27432436 CCCTGGGGCTCTCTGCCCTGTGG + Intronic
1136231273 16:28887050-28887072 CCTGGGGGATGTCTGGACTCTGG - Intronic
1137588740 16:49680549-49680571 CCTTGGGGTTCTGTGGTTCCTGG + Intronic
1137972793 16:53002195-53002217 GCTGGGGTCTCTTTGGTCTCTGG - Intergenic
1138925040 16:61580943-61580965 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1139138618 16:64234149-64234171 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1139269234 16:65666474-65666496 CCATGGGGCTCTCTGAGCCCAGG - Intergenic
1139504262 16:67391276-67391298 CCTTGGGGCTCTGTGGCCCAGGG - Exonic
1139639922 16:68284010-68284032 TCTAGGAGCTCTCTGTTCTCTGG + Intronic
1139957349 16:70699456-70699478 ACTTAGGGCTCGCTGGTCCCTGG + Intronic
1140888355 16:79263990-79264012 TCTTGGGGCTCTCTTGCCACAGG - Intergenic
1141470934 16:84237839-84237861 CTTCTGGGCTCTGTGGTCTCAGG + Intronic
1141925767 16:87168158-87168180 CCTAGGAGCTCTGTGGTCTTGGG - Intronic
1144505114 17:15822826-15822848 CTTGGCTGCTCTCTGGTCTCAGG + Intergenic
1144645399 17:16970350-16970372 CTTGGCTGCTCTCTGGTCTCGGG - Intronic
1144767409 17:17740175-17740197 CCTTGGGCTTCTCTGTGCTCAGG + Intronic
1145169291 17:20640709-20640731 CTTGGCTGCTCTCTGGTCTCAGG + Intergenic
1146674982 17:34767216-34767238 CCTTCCGGCTCTGTGGTTTCAGG - Intergenic
1147036445 17:37685085-37685107 CCTTGGGGCTCTCAGTTGCCAGG + Intergenic
1147605561 17:41772059-41772081 CCCTGGGGCTCACTGCTCCCAGG - Intronic
1149013223 17:51879651-51879673 CTTTGGGACACTCTGTTCTCTGG - Intronic
1149169588 17:53792966-53792988 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1150076758 17:62198746-62198768 CCTTAGGGCTCTGAGGCCTCAGG + Intergenic
1153617192 18:6945935-6945957 CTTTGGGGCTGTCTGGGCGCAGG - Intronic
1156327365 18:36086173-36086195 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1156453824 18:37281724-37281746 TCATGGGGTGCTCTGGTCTCTGG - Intronic
1157544122 18:48536005-48536027 CCTGGGGGAACTCTGGTCTGAGG + Intergenic
1157885018 18:51358527-51358549 TCTGGGTGCTCTCTGATCTCAGG + Intergenic
1159292504 18:66440386-66440408 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
1159677904 18:71309051-71309073 CCTGAGGGGTCTCTTGTCTCTGG + Intergenic
1160083488 18:75753250-75753272 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1160532574 18:79574165-79574187 CTTTGGGGAGCTCTGGCCTCTGG - Intergenic
1161025165 19:2033494-2033516 CCTAGGGTCTCTCTTCTCTCTGG - Intronic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1161705455 19:5818815-5818837 CAATGGGCCTCTCTGTTCTCGGG - Intergenic
1162572982 19:11483255-11483277 GCTTGGGGGTCTGGGGTCTCTGG - Intronic
1163002452 19:14376512-14376534 CTTTTGGGCTGTGTGGTCTCAGG - Intergenic
1163294516 19:16403679-16403701 TCTTGGGGCTCGCTGGTCCCTGG + Intronic
1163300518 19:16442830-16442852 TCTTGGGGCTCTGAGGTGTCGGG - Intronic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1164881836 19:31739312-31739334 CCTTGGAGCTCTGTCCTCTCTGG + Intergenic
1164944929 19:32285606-32285628 CCTTGGGGGTCTCTCTTCTCTGG - Intergenic
1165092359 19:33393823-33393845 CCTTGGGGTGGTCTGGCCTCTGG - Intronic
1165396019 19:35563837-35563859 CCCAGGGGCTCCCTGATCTCAGG - Intergenic
1165778154 19:38417051-38417073 CCTTGGTGCTGTCAGGGCTCAGG + Exonic
1166849777 19:45753949-45753971 ACTTGGGGTTCACTGGTCTATGG + Intronic
1167373339 19:49097935-49097957 CCTTGGGGCAGCTTGGTCTCAGG + Intronic
1167409359 19:49335837-49335859 CCTGGGGTCTCCCTTGTCTCAGG + Intronic
1167769867 19:51508475-51508497 CCTGGGGGCTGCCTGGCCTCGGG - Intergenic
1168563556 19:57403834-57403856 CCTTGGGGCTCTGTGGTTGCTGG + Intronic
925396057 2:3534496-3534518 CCTTGGGGCTCTGCGGTTCCTGG + Intronic
925747619 2:7056935-7056957 CCTTGGGGCTCTTAGTTCTTTGG + Intronic
926326095 2:11785992-11786014 CATGGGGGCTCTCTGGACACTGG + Intronic
926803267 2:16681410-16681432 CCTTGGGTCTAGCTGGGCTCTGG - Intergenic
927492278 2:23528539-23528561 CCTGGAGGCTCTCTGGGCTCAGG - Intronic
927743082 2:25590119-25590141 CCTTGGGGCTCTGTGGTTCCTGG - Intronic
928425197 2:31172006-31172028 CCTTTGGGGTCACTGGTCTCAGG - Intergenic
929772713 2:44905922-44905944 CTATGGGTCTTTCTGGTCTCTGG - Intergenic
929847036 2:45541279-45541301 CTTTGGGACTCTCTGGTTCCTGG - Intronic
930668226 2:54120837-54120859 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
932119077 2:69081681-69081703 CCTTAGGGCTGTGTGGTCTTGGG - Intronic
932314800 2:70772860-70772882 GTCTGGGGCTCTCTTGTCTCTGG - Intergenic
932960388 2:76406487-76406509 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
935096376 2:99948189-99948211 ACTCGGAGCTCTCTGGTCTGTGG + Intronic
936090805 2:109500337-109500359 CCCAGGGGCTCTCTGGGCTGTGG - Intronic
940711109 2:157164714-157164736 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
941131154 2:161651568-161651590 CTTTGGGGCTCTGCGGTTTCTGG + Intronic
941834132 2:169997428-169997450 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
942054614 2:172170791-172170813 GCTTGGGGCTTTTTGTTCTCTGG + Intergenic
942114256 2:172712660-172712682 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
942552786 2:177137196-177137218 ATTTGGGGCATTCTGGTCTCGGG - Intergenic
942728689 2:179039548-179039570 ACTTAAGTCTCTCTGGTCTCAGG - Intronic
943224064 2:185145470-185145492 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
943346045 2:186738074-186738096 CCTTGGGGCTCCGTGATCACTGG - Intronic
943858508 2:192828946-192828968 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
947654652 2:231816495-231816517 CCTTGGGCCTCTCTATTCCCTGG - Intergenic
947792333 2:232875626-232875648 CCTTTCTGCTCTCTGGTCCCTGG + Intronic
948464780 2:238147289-238147311 CCTGGGTGCTTTCTGCTCTCTGG - Intronic
1170221652 20:13947711-13947733 CTTTGGGGCACTGTGGTTTCTGG + Intronic
1170327940 20:15176871-15176893 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1170458469 20:16554752-16554774 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1171235279 20:23519420-23519442 CCTTTCTGCTCTATGGTCTCTGG - Intergenic
1172092829 20:32446034-32446056 CCTGGGGCCTCTCTGCTCTGAGG + Exonic
1172117307 20:32580806-32580828 ACTTGGGGCTCTCTGATCCTAGG + Intronic
1172191490 20:33064467-33064489 CCTTGGGGCTCTTGGGTCCGTGG + Exonic
1172888141 20:38245648-38245670 CTTGGGGGCTCCCTGGTCTTGGG - Intronic
1173764336 20:45593567-45593589 CCTAGGTGTTCACTGGTCTCAGG + Intergenic
1175292129 20:57882798-57882820 CCTGGGGGCTCACAGGGCTCTGG + Intergenic
1175763468 20:61576881-61576903 CCTTGGGACTCTAGGGTCTTGGG + Intronic
1175845534 20:62056579-62056601 CCTTGGCCCTCGGTGGTCTCAGG - Intronic
1176211980 20:63929079-63929101 CCTTGGGGCTCCCTCCTCTGAGG + Intronic
1176382311 21:6119564-6119586 CTTTGTGGCTCCCTGGGCTCTGG + Intronic
1178337191 21:31753879-31753901 ACATGGGGCCCACTGGTCTCAGG + Intergenic
1178467000 21:32858213-32858235 CCTTGGGGCCCTGTGATTTCTGG - Intergenic
1178750204 21:35295626-35295648 CCTTGTGGCTGTCGGGTCGCTGG - Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1179632934 21:42689730-42689752 CATTTGGGCTCTTTGGGCTCAGG - Intronic
1179638605 21:42731895-42731917 CCCTGGGGCTCTCTGGGCCTGGG - Exonic
1179741161 21:43418675-43418697 CTTTGTGGCTCCCTGGGCTCTGG - Intronic
1179873671 21:44256666-44256688 CCTTGGGGCTCTCTTCTCCGAGG - Intronic
1180135162 21:45857800-45857822 GCTTGAGGCTTTCTGGTCACTGG - Intronic
1180957870 22:19749311-19749333 GCTTGGGGGTCTCTGGACACAGG - Intergenic
1183320953 22:37164737-37164759 CCTGGTGGCCCTCTGCTCTCTGG - Intronic
1183520483 22:38293774-38293796 CCTGGGGGCTCCCTGATGTCAGG + Intronic
1183530621 22:38351487-38351509 CCTTGCTGCTCTCTGGACTCTGG + Intronic
1183629980 22:39027054-39027076 TCTAGGGCCTCTCTGGTCCCTGG - Intronic
1183633415 22:39046919-39046941 TCTATGGCCTCTCTGGTCTCTGG - Intronic
1183872304 22:40749024-40749046 CCTTGGGGCTCTGTGGTTGCTGG + Intergenic
1183872824 22:40753460-40753482 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
1184543853 22:45151895-45151917 CTTTGGGCTCCTCTGGTCTCTGG - Intergenic
1184616139 22:45639960-45639982 CCCTGGGGCTCACAGCTCTCAGG - Intergenic
952209822 3:31218942-31218964 CCTTGGGGCTGTGTGCTCTTTGG + Intergenic
952657269 3:35801524-35801546 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
953147340 3:40290878-40290900 CCTTGGGGCTCTGTGGTTGCTGG - Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
954985587 3:54788404-54788426 ACTTGGGGCTCTAAGGTGTCTGG - Intronic
955788960 3:62568543-62568565 GCTGGGGGCTCTCAGGTCTTTGG + Intronic
956142890 3:66163450-66163472 GCTAGGGGCTGTCTGGACTCTGG + Intronic
957313021 3:78543676-78543698 CCTTGGGCCTCTTTAGTCTTTGG - Intergenic
957614591 3:82510140-82510162 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
957665086 3:83217284-83217306 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
957788060 3:84906036-84906058 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
958586919 3:96098993-96099015 GCTTGGGGCTCTCGGGCCTTTGG + Intergenic
958877576 3:99633440-99633462 CCTAGGGGCTCTCGGGCCTTCGG + Intergenic
959527042 3:107388926-107388948 CCTTGGGGCTCACAGGCCTTGGG - Intergenic
959776590 3:110171777-110171799 CCAAGGGCCTCTCTGGTCCCTGG + Intergenic
962866756 3:139453560-139453582 CCTGTGGGCTTTCTGGCCTCTGG + Intronic
963250292 3:143096362-143096384 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
963346361 3:144099872-144099894 CTTTGGGGTTCTGTGGTTTCTGG + Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
965118679 3:164522381-164522403 CCTTGGCCCTCTCTGGACTTTGG - Intergenic
965258276 3:166444756-166444778 CCTTGGGGCCCTGTGGTGGCTGG + Intergenic
965773873 3:172208995-172209017 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
966400813 3:179545402-179545424 CTTTGTGGCGGTCTGGTCTCAGG - Intergenic
967951097 3:194841324-194841346 CCTCAGGGCTCTCTTGGCTCTGG + Intergenic
968980696 4:3847920-3847942 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
969022134 4:4145805-4145827 TCTAGGTGCTCTCTGGTCCCGGG - Intergenic
969731732 4:8961587-8961609 TCTAGGCGCTCTCTGGTCCCGGG + Intergenic
969791328 4:9495694-9495716 TCTAGGGGTTCTCTGGTCCCGGG + Intergenic
971825309 4:31614136-31614158 CCTTGGGACTCTGTGGTTGCTGG - Intergenic
972645922 4:40967446-40967468 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
974589250 4:63921897-63921919 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
974607771 4:64174529-64174551 CCTTGGGGCTCTGCGGTTCCTGG + Intergenic
975485914 4:74933858-74933880 TCTTGGCGGTCTCTGATCTCCGG + Intronic
978347553 4:107788048-107788070 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
979724387 4:123942734-123942756 CCTTGGGGCTCCATGGTTGCTGG + Intergenic
979946891 4:126843574-126843596 CCTTGGGGCTCTGAGGTTACTGG + Intergenic
980253536 4:130348842-130348864 TCTTTGGGCTCTCTGGTTCCTGG - Intergenic
981300282 4:143178971-143178993 CCTTAGGGATGTCTGGTATCAGG + Intergenic
982611143 4:157575359-157575381 CTTTGGGGCTCTATGGTTCCTGG + Intergenic
984763908 4:183384965-183384987 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
985279407 4:188270575-188270597 CCTTCGGCTTCTCTGGTTTCTGG + Intergenic
985522277 5:380961-380983 CCTGGGGGCTCTCAGGCCTTTGG - Intronic
985588489 5:752932-752954 GCTTTGGTCTCTGTGGTCTCTGG - Intronic
985767326 5:1786932-1786954 CCTTGGGACTCACAGGCCTCAGG - Intergenic
985948410 5:3204193-3204215 CCTTGGACTTCTCAGGTCTCTGG + Intergenic
986030580 5:3889264-3889286 GCTTCGGCCACTCTGGTCTCTGG + Intergenic
986486417 5:8242704-8242726 CCTAGGGCCTCTATGGTCTCTGG + Intergenic
986697105 5:10367173-10367195 CCTTGGGCTCCTCTGGGCTCGGG - Intronic
989282914 5:39665457-39665479 CCTTGGGGCTCCGTGGTTGCTGG + Intergenic
989821785 5:45801213-45801235 CTTTGGGGCTCTGTGTTTTCTGG + Intergenic
991039581 5:62162005-62162027 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
993617929 5:90136295-90136317 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
995386717 5:111596707-111596729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
995395195 5:111679888-111679910 CCTTGGGGCTCTGCGGTTGCTGG - Intronic
999545735 5:152626343-152626365 CCCTGGGGCTCTCAGGCCTTTGG + Intergenic
1000188795 5:158887977-158887999 CCATGGGGCTCTCTGTTTCCAGG + Intronic
1000266361 5:159641661-159641683 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1000282970 5:159798182-159798204 CTTTGGCACTCTCTGGTCTAGGG + Intergenic
1001240631 5:170067339-170067361 TCTGGGGGCTGTCTGCTCTCTGG - Intronic
1001692834 5:173645680-173645702 CCTGGGGGCTCTCTGCACCCAGG + Intergenic
1001859475 5:175040896-175040918 CCTTGTGGCTCTTGAGTCTCTGG + Intergenic
1004089001 6:12480220-12480242 TCTGAGGTCTCTCTGGTCTCTGG - Intergenic
1004720883 6:18266326-18266348 CCTTGGCCCTCTCTGGACTTTGG - Intergenic
1006691852 6:35895005-35895027 TCTCAGAGCTCTCTGGTCTCTGG - Intronic
1007214874 6:40229065-40229087 TCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1007377991 6:41469438-41469460 CCTTGGGGGTCTCTGGGGTGGGG - Intergenic
1007606821 6:43123552-43123574 CCGTGTTGCTCTCTGGGCTCAGG - Intronic
1008231684 6:48990731-48990753 CTTTGGGTCTCTGTGGTTTCTGG + Intergenic
1009243283 6:61204436-61204458 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1009588717 6:65638508-65638530 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1009631205 6:66202990-66203012 CCTTGGGGCTCCATGGTGGCTGG + Intergenic
1012316803 6:97791190-97791212 CCTTGGGGCTCCATGGTCGCTGG - Intergenic
1013050295 6:106527364-106527386 AATTGGAACTCTCTGGTCTCTGG + Exonic
1014418662 6:121214619-121214641 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1017159449 6:151351254-151351276 CCCCGGGCCTCTCTGTTCTCTGG - Exonic
1017220763 6:151962666-151962688 CCTTGTGGCTCTTTGATCTCTGG + Intronic
1018188302 6:161286987-161287009 CCCTGTGACTCTGTGGTCTCTGG - Intergenic
1018365996 6:163120475-163120497 CAGTGTGGCTGTCTGGTCTCAGG - Intronic
1018559860 6:165090534-165090556 CCTGGGGGCTGGCTGGTCTAAGG - Intergenic
1019629198 7:2037784-2037806 CCTTGGGCCTCTCTATTCCCTGG + Intronic
1019736543 7:2652723-2652745 CCTCAGGGCTCTGTGGTCTCTGG + Intronic
1020485662 7:8716862-8716884 GCATGGGGCACTCTAGTCTCTGG + Intronic
1020586879 7:10079632-10079654 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1020762910 7:12290114-12290136 CCTTGGGGCTCTATGGTTGTTGG + Intergenic
1021343030 7:19488433-19488455 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1022671037 7:32456462-32456484 CCTTGGAACTCTATGGTTTCAGG - Intergenic
1022776072 7:33529026-33529048 AGCTGTGGCTCTCTGGTCTCTGG + Intronic
1024024724 7:45400593-45400615 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1024270042 7:47635313-47635335 CCTCGGTGCGCTCAGGTCTCAGG + Intergenic
1024995490 7:55270753-55270775 CCTGGGGGGTCTATGGTCTTGGG - Intergenic
1026391944 7:69911305-69911327 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1026393517 7:69927867-69927889 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1029702167 7:102254332-102254354 TCTTGGGTGTCTCTTGTCTCTGG + Exonic
1029705637 7:102274373-102274395 CTTTGGGGATCTGTGTTCTCAGG - Intronic
1030722035 7:112882002-112882024 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1030756420 7:113292178-113292200 CTTTGGGGCTCTATGGTTCCTGG + Intergenic
1031196961 7:118627551-118627573 CCTTGGAGCTCTGTGGTTGCTGG + Intergenic
1032396925 7:131597151-131597173 CCTTGGTGGTCTCAGGTCTGGGG + Intergenic
1032649038 7:133857783-133857805 CCTTGGGGCTCTGTGGTTGCTGG - Intronic
1032787897 7:135215428-135215450 CCATGGCACTCTCTGGTTTCTGG - Intergenic
1034632825 7:152543950-152543972 CCTGGGGGGCCTCTGGGCTCTGG + Intergenic
1035066131 7:156106186-156106208 CCCTGGGGCTCCCTGGTGTGAGG + Intergenic
1035705234 8:1669975-1669997 CCCTGGGCCTCGCTGGGCTCCGG + Intronic
1036175296 8:6532014-6532036 CCCTGGTGCTTTCTGGACTCCGG - Intronic
1037539569 8:19857998-19858020 CCTTGGGGCTCCGTGGTTGCTGG - Intergenic
1037827855 8:22170021-22170043 CCTTGGGGCTCTGTGCTTTTGGG - Intronic
1039210065 8:35204008-35204030 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1039984345 8:42435562-42435584 ACTTGGGGCTCTCAGGCCCCAGG + Intronic
1040937551 8:52796899-52796921 CCTTGGTGCTCCCTGACCTCTGG + Intergenic
1041965399 8:63669700-63669722 CTTTGAGGCTCTGTGGTTTCTGG - Intergenic
1042005004 8:64169934-64169956 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1042439586 8:68810408-68810430 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1042681313 8:71388206-71388228 CCTTGGGGATCACTGGTGTCTGG - Intergenic
1042863450 8:73335901-73335923 CCCTGGGGATCCCTGGGCTCTGG + Intergenic
1043070614 8:75631350-75631372 CCTTGGGGCTTCCCTGTCTCTGG - Intergenic
1043702765 8:83312303-83312325 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1044774864 8:95677638-95677660 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1044820458 8:96152760-96152782 CCTTGGACCCCTCTGGTCTTTGG - Intronic
1045888127 8:107123532-107123554 TCTTGGGGCTCTGTGGTTCCTGG + Intergenic
1046407246 8:113790608-113790630 CTTTGGGGCTCTGTGGTTCCCGG - Intergenic
1048874020 8:138822614-138822636 CCCTGGGGCTCCCTGCTCCCAGG + Intronic
1049056282 8:140239686-140239708 CCCCTGGGCTCTCTGGCCTCAGG + Intronic
1049769695 8:144374155-144374177 ACTTGCGGGTCTCGGGTCTCTGG - Intronic
1049791419 8:144474371-144474393 CCTGGGGGCCCTCGGGTTTCAGG + Exonic
1049791732 8:144475442-144475464 CCTTGAGGCCCTCAGCTCTCAGG + Intronic
1050428734 9:5539641-5539663 CCTGGGGCCTCTCTGTTCTTTGG - Intronic
1050484050 9:6115140-6115162 CTTTGGGGCCCTGTGGTTTCTGG + Intergenic
1052623607 9:30944889-30944911 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1055351086 9:75389097-75389119 TCTTGGGTCTCTCTGGGCACAGG - Intergenic
1055882984 9:81024073-81024095 CCTGGGGGCTCTCTGGCCTTTGG + Intergenic
1055890827 9:81122135-81122157 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1056334598 9:85554580-85554602 CTCAGGGGCTCTCTGGACTCAGG + Intronic
1056462247 9:86819032-86819054 TTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1057192878 9:93097006-93097028 CCCAGGGCCTCTCTGGTCTGGGG + Intronic
1057303997 9:93902110-93902132 CCCAGGAGCTCTCTTGTCTCAGG - Intergenic
1057547581 9:96029819-96029841 CCTTGGGGCCTTGTGGTCTTAGG + Intergenic
1057695938 9:97323108-97323130 GCCTGGTGCTCACTGGTCTCTGG + Intronic
1058757143 9:108093704-108093726 CCTTGGGGTTCTCTTTTCTGTGG + Intergenic
1059104911 9:111502453-111502475 CTCTGGGGCTCTGTGGTTTCTGG + Intergenic
1059344214 9:113617088-113617110 CCTCTGGGCTCCCTGGTCTGAGG - Intergenic
1059419456 9:114181888-114181910 CCCAGGTGCTCTGTGGTCTCTGG + Intronic
1059590866 9:115660096-115660118 TCTTGGGGCTCACTCGTGTCAGG - Intergenic
1061571184 9:131478292-131478314 CCTTGGGCCTCTTTGGTTTGGGG + Intronic
1061950795 9:133934848-133934870 GCTTCTGTCTCTCTGGTCTCTGG + Intronic
1062326423 9:136014666-136014688 CCTGAGGGCTCTCTGGTATCTGG - Intronic
1062553093 9:137099369-137099391 CCTTGGGCCTCGGTGGCCTCTGG - Intronic
1062682133 9:137787791-137787813 CCTGGGGGCCCTCAGGTTTCAGG + Intronic
1185936057 X:4257991-4258013 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1187871119 X:23766298-23766320 CTTTGGGGCTCTGCGGTTTCTGG - Intronic
1188647966 X:32592802-32592824 CCTTGGGGCTCTGTGGTTCCTGG + Intronic
1189213100 X:39301266-39301288 CCATGGGACTCTCTGATGTCTGG - Intergenic
1192676194 X:73199295-73199317 CCTTGGGACTTGCTGGTTTCTGG + Intergenic
1192847472 X:74921349-74921371 CCTTGGGGAAATCTGGTCTGGGG - Intronic
1194123404 X:89987269-89987291 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
1197158170 X:123292905-123292927 CCTTAGGGCTTTCTGGTAACAGG + Intronic
1198855432 X:141010667-141010689 TCTTGGGGCTAGCTTGTCTCTGG - Intergenic
1198907263 X:141576701-141576723 TCTTGGGGCTAGCTTGTCTCTGG + Intergenic
1198909528 X:141597700-141597722 TCTTGGGGCTAGCTTGTCTCTGG - Intronic
1200476290 Y:3644886-3644908 CCTTGGGGCTCCATGGTTGCTGG - Intergenic
1200621463 Y:5454321-5454343 CCCTGTGGCTTTCTGGTCTTTGG + Intronic
1201383597 Y:13413598-13413620 CTTTGGGGCTTTGTGGTTTCTGG + Intronic
1201562334 Y:15331540-15331562 TCTTGGGGCACCATGGTCTCTGG - Intergenic