ID: 953410036

View in Genome Browser
Species Human (GRCh38)
Location 3:42685606-42685628
Sequence TAGGCCACCCACCATGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953410030_953410036 -9 Left 953410030 3:42685592-42685614 CCGCCACCGCACCCTAGGCCACC 0: 1
1: 0
2: 2
3: 41
4: 423
Right 953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
953410025_953410036 2 Left 953410025 3:42685581-42685603 CCCCCTTGGCACCGCCACCGCAC 0: 1
1: 0
2: 0
3: 15
4: 111
Right 953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
953410028_953410036 -1 Left 953410028 3:42685584-42685606 CCTTGGCACCGCCACCGCACCCT 0: 1
1: 0
2: 1
3: 11
4: 244
Right 953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
953410026_953410036 1 Left 953410026 3:42685582-42685604 CCCCTTGGCACCGCCACCGCACC 0: 1
1: 0
2: 1
3: 16
4: 137
Right 953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
953410027_953410036 0 Left 953410027 3:42685583-42685605 CCCTTGGCACCGCCACCGCACCC 0: 1
1: 0
2: 1
3: 16
4: 153
Right 953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953410036 Original CRISPR TAGGCCACCCACCATGGCGC TGG Exonic
903327939 1:22582038-22582060 CAGGCCATCCACCAAGGAGCCGG - Intronic
905670040 1:39785488-39785510 TAGGCCTCCCACCATGGCTCAGG - Intronic
913933335 1:125008166-125008188 TAGGGCTCCCACCATTGCCCAGG + Intergenic
922254033 1:223876067-223876089 CAGGCCACCCACCACAGCACTGG + Intergenic
923090508 1:230736978-230737000 TAAGCCAACCACCCTGGAGCTGG + Intergenic
1063565631 10:7170690-7170712 TCCGCCCCCCACCATGGCACTGG + Intronic
1064142068 10:12798982-12799004 TGTGCCACCCACCGTGGAGCTGG - Intronic
1065660268 10:27998885-27998907 TAGGCCTCCCACAAGGGCGCCGG - Intronic
1073105477 10:101030210-101030232 TAGCCCAGCCGCCATGGCGCAGG - Exonic
1077564236 11:3286329-3286351 TAGGCCAGGCGCCATGGCTCAGG - Intergenic
1077570126 11:3332146-3332168 TAGGCCAGGCGCCATGGCTCAGG - Intergenic
1081608526 11:44543697-44543719 TAGGCCAACCACCTTGCAGCAGG - Intergenic
1090180582 11:124695696-124695718 TGGGCCATCCACTATGGTGCAGG - Exonic
1090800795 11:130170470-130170492 TGGTCCACCCAGCATGGTGCAGG + Intronic
1091281217 11:134382953-134382975 CAGGCCACCCACGAAGGCGACGG + Exonic
1091767903 12:3133841-3133863 TTGATCACCCACCATGGCACGGG + Intronic
1099202183 12:79690276-79690298 CAGGCCGCCCACCAGGGCTCCGG + Exonic
1119333060 14:73809849-73809871 CAGGCCACCCTACATGGAGCTGG + Intergenic
1122847442 14:104507565-104507587 TAGGCCAGGCACCATGGTGATGG - Intronic
1124006185 15:25797408-25797430 CAGGGCAGCCACCATGGCACTGG - Intronic
1129797792 15:78391283-78391305 TAGGTCACCTTCCATGGAGCAGG - Intergenic
1131508525 15:93036271-93036293 TAGGCCACCCCCGATGTGGCTGG - Intronic
1133017188 16:2949466-2949488 TGGGCCACCCAGGATGCCGCTGG - Exonic
1136298419 16:29317119-29317141 CATGCCACCCACCAAGGCACAGG + Intergenic
1138230268 16:55331310-55331332 TCCCCCACCCACCATTGCGCGGG - Intergenic
1141723010 16:85767356-85767378 AAGGCCACCCACTGTGGCGAGGG + Intergenic
1143192696 17:5051958-5051980 TAGGCCAGGCACCGTGGCTCAGG + Intronic
1147498039 17:40936548-40936570 TCGGCCTCCTTCCATGGCGCCGG - Exonic
1151967538 17:77439320-77439342 CAGGTGACCCACCATGGCACAGG + Intronic
1152076743 17:78164576-78164598 CAGGGCACCCACCATCGTGCTGG + Intronic
1156503327 18:37573774-37573796 TTGGGCACCCACCATGTAGCAGG - Intergenic
1161616521 19:5274002-5274024 GAGGCCACACAGCATGGAGCTGG + Intronic
1161729648 19:5951517-5951539 GAGGCCCCCCACCATGGCACGGG - Exonic
1163483545 19:17572983-17573005 GAGGCCATCCACCCTGGCCCTGG - Intronic
1165898448 19:39156803-39156825 TGGGCCACCCTCAATGGGGCGGG - Intronic
929794585 2:45049376-45049398 AAGGCAACACATCATGGCGCAGG + Intergenic
932816186 2:74864079-74864101 TTGGCCACCCTACATGGCCCTGG + Intronic
935268152 2:101411970-101411992 TGGGCCACCCAGCATTGCACTGG - Intronic
941750415 2:169129800-169129822 TGGGCCACGCACCATGGTCCAGG - Intronic
946844631 2:223848492-223848514 TCTGGCACCCACCATGGCTCTGG - Intergenic
1173201390 20:40957720-40957742 TAGGCCCTCCACCATGTAGCTGG - Intergenic
1173202256 20:40962713-40962735 TAGGGCACCCACCATGTCCCAGG - Intergenic
1174263854 20:49317633-49317655 GAGGCCAGGCACCATGGCTCAGG - Intergenic
1174391633 20:50221503-50221525 TATACCACCCACGATGGCTCAGG + Intergenic
1175568760 20:60002356-60002378 TGGAACACCCACCATGGCACAGG + Intronic
1175982368 20:62745120-62745142 TGGGCCACCCTCCCTGGAGCCGG - Intronic
1181162814 22:20967863-20967885 TAGGGCGCCCCCCATGGGGCTGG - Exonic
1181175290 22:21031803-21031825 TCGGCCACCTGCCATGGCCCGGG - Exonic
1182414267 22:30210773-30210795 CAGGCCTCCCACCAGGGCTCTGG - Intergenic
1182784405 22:32894778-32894800 AAGCCCACCCACAATGGCTCAGG - Intronic
1184230748 22:43157184-43157206 AAGGCCACCCTCCCTGGGGCAGG - Intronic
1184652069 22:45924013-45924035 TGGGCCTCCCTCCATGGCCCCGG + Intronic
1185248596 22:49787183-49787205 CAGGCCCCCCACGAAGGCGCCGG + Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950589046 3:13922304-13922326 CAGGCCACAAACCATGGCCCAGG + Intergenic
953410036 3:42685606-42685628 TAGGCCACCCACCATGGCGCTGG + Exonic
954482391 3:50812685-50812707 TGGGCCACTCACAATGGGGCGGG + Intronic
961182363 3:124886991-124887013 GAGGCGCCCCACCATGCCGCGGG - Exonic
961642223 3:128371782-128371804 TAGGGCCCCTACCATGGGGCTGG - Intronic
962844115 3:139260402-139260424 GAGGCCACACACCAGGGGGCAGG - Intronic
967955767 3:194876329-194876351 TAGTCCTCTCACCATGGCCCGGG - Intergenic
968653962 4:1770762-1770784 CAGGACACCCACCATCGGGCAGG + Intergenic
969304147 4:6315897-6315919 TAGGCTTTCCACCATTGCGCCGG + Intergenic
969687065 4:8681603-8681625 TTCCCCACCCCCCATGGCGCTGG - Intergenic
969749836 4:9101593-9101615 TAGGCCACCCGCCTTGGCCAGGG - Intergenic
974013375 4:56627123-56627145 TGGGCCACCCACCTGGGCCCTGG - Intergenic
976431235 4:84965991-84966013 CAGGCCGCCCACCCTGGCGGCGG + Intronic
985238376 4:187901876-187901898 CAGGCCATCCATCATGACGCAGG - Intergenic
985623941 5:974448-974470 TAGTCCACCCAGCAGGGTGCTGG + Intergenic
996884023 5:128334508-128334530 TGAGCCACCCACCGTGGGGCTGG - Intronic
999341575 5:150778147-150778169 TGGGCCACCCACAGTGGCGTGGG + Exonic
1004986257 6:21086509-21086531 TAGTTCACCCACCTAGGCGCTGG - Intronic
1011163381 6:84418447-84418469 TATGCCACTCAGCATGGCTCTGG + Intergenic
1019057745 6:169235371-169235393 GAGGCCACCCTCCATGGCAGAGG - Intronic
1019797071 7:3058279-3058301 TAGGCAAACCATCATGGAGCCGG + Intergenic
1020323150 7:6955049-6955071 TAGGCCACCCACCTTGGCCAGGG + Intergenic
1032363645 7:131278878-131278900 TAGGCCAGGCACAATGGCTCAGG - Intronic
1040084545 8:43326127-43326149 AAGGGCACCCACCATTGCCCAGG - Intergenic
1040090776 8:43396626-43396648 AAGGGCACCCACCATTGCCCAGG - Intergenic
1049411091 8:142474323-142474345 GAGGGGACCCACCATGGAGCTGG - Intronic
1053729578 9:41039615-41039637 TATGCCAACCAGCATGGCCCTGG - Intergenic
1054698929 9:68392447-68392469 TATGCCAACCAGCATGGCCCTGG + Exonic
1060661081 9:125405599-125405621 CAGGCCACCCACTCTGGCCCTGG + Intergenic
1062590733 9:137273363-137273385 CAGGACACCCACCATGGCACAGG - Exonic
1190320903 X:49178700-49178722 AAGGCCACCCACCATGGGTAGGG - Intronic
1197082998 X:122441074-122441096 CAGGCCAGCCCCCATGGCTCTGG - Intergenic
1200116778 X:153772983-153773005 TTGGCCACCCACGAAGGCACTGG - Exonic