ID: 953411800

View in Genome Browser
Species Human (GRCh38)
Location 3:42694628-42694650
Sequence CATGATGAACTGGGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953411800_953411806 -10 Left 953411800 3:42694628-42694650 CCATGCTCCCCCAGTTCATCATG 0: 1
1: 0
2: 2
3: 19
4: 221
Right 953411806 3:42694641-42694663 GTTCATCATGCTGGCCTCACTGG 0: 1
1: 0
2: 0
3: 54
4: 1110
953411800_953411809 20 Left 953411800 3:42694628-42694650 CCATGCTCCCCCAGTTCATCATG 0: 1
1: 0
2: 2
3: 19
4: 221
Right 953411809 3:42694671-42694693 TACCTTTACACCCACACAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953411800 Original CRISPR CATGATGAACTGGGGGAGCA TGG (reversed) Intronic
900454557 1:2767759-2767781 GATGCTCAACTGGGGGTGCAGGG - Intronic
900456075 1:2775384-2775406 GATGCTCAACTGGGGGTGCAGGG - Intronic
901854934 1:12038528-12038550 CATGATGAAGTGGGAGTGGAAGG - Intergenic
902407667 1:16194420-16194442 CAAGATGAGCTTGGGGAACATGG + Intergenic
903068810 1:20716548-20716570 CAGGGAGAACTGGGGGAGCTGGG + Intronic
903083268 1:20830732-20830754 CATGATGAACTGACTGATCAAGG - Intronic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
904613203 1:31736382-31736404 CAGGCAGACCTGGGGGAGCAGGG + Exonic
904969893 1:34411265-34411287 CAGGATGATTTGGGGGAGCAGGG - Intergenic
911750205 1:101487769-101487791 CATGATGACCTTTGGAAGCAAGG + Intergenic
913478854 1:119265321-119265343 CAAGATCAGCTGGGGGAACATGG + Intergenic
913654346 1:120946955-120946977 CATGATCAACTGAGCAAGCAAGG - Intergenic
914819887 1:151092775-151092797 CAAGATGAACCTGGGGAACATGG - Intronic
915249414 1:154577727-154577749 CAGGAAGAGCTGGGGGAGCTGGG + Exonic
915327089 1:155086155-155086177 CATGGTGAACTGGGGGAGAGTGG - Exonic
917609680 1:176674406-176674428 CAGGAGGAAGTGTGGGAGCAGGG - Intronic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921930608 1:220751476-220751498 AATGATGAACTGTTGGAGAAAGG + Intronic
922179371 1:223221957-223221979 CATGGGGAACCGGGGCAGCAGGG - Exonic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
1063425873 10:5949640-5949662 CATTAGGAAGTGGGAGAGCAGGG - Intronic
1063442352 10:6083192-6083214 CATGTTTTCCTGGGGGAGCAAGG + Intergenic
1064876511 10:20001003-20001025 CAGGATGAGCTGGGTCAGCAAGG + Intronic
1067109484 10:43390091-43390113 CATGCTGATCTGGCAGAGCAAGG + Intronic
1070442588 10:76461641-76461663 GATGGTGAACTGGGAGAGCCAGG + Intronic
1075275315 10:121087460-121087482 CATTAGGATCTTGGGGAGCAGGG - Intergenic
1075649459 10:124118210-124118232 ACAGGTGAACTGGGGGAGCACGG + Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1079025205 11:16941732-16941754 CATGAAGAAGTGGGTGAGCTAGG + Intronic
1080521605 11:33072235-33072257 CATGATGAACAAGATGAGCATGG + Intronic
1080643335 11:34170968-34170990 CATGCTCAACTGTGGGAGGACGG - Exonic
1081603783 11:44513875-44513897 CAAGATGAAATGGGAGAGGAAGG - Intergenic
1082813188 11:57491270-57491292 CATCATGGACTGGCGGATCAAGG - Exonic
1085017104 11:73181277-73181299 CATGCTGAGCTGGAGGTGCACGG + Intergenic
1085386853 11:76162552-76162574 CATGCTGCACTGTGGGGGCAGGG + Intergenic
1085688815 11:78649397-78649419 CATGTGGACCTGGGGGAGCCTGG - Intergenic
1086289693 11:85293103-85293125 AATGATTAAATGGGGGAGAAGGG + Intronic
1086583677 11:88427686-88427708 CATGATAAATTGGGGCAGGAGGG + Intergenic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1088877850 11:113950755-113950777 CATGATGAACTGGGGCTGCCTGG - Intergenic
1089073184 11:115716930-115716952 GATGATGAGATGGGGGGGCACGG + Intergenic
1091754114 12:3040699-3040721 CGGGAGGGACTGGGGGAGCAAGG + Intergenic
1091877388 12:3947181-3947203 CATGATGAGCTAGGGGAGTCAGG - Intergenic
1092494637 12:8980551-8980573 CATGGTGCACTGGGTCAGCATGG + Intronic
1098251648 12:68576217-68576239 CATGTTTAACTGTGTGAGCATGG + Intergenic
1101022606 12:100568563-100568585 ATAGATGAACTGGGGGAGTAGGG + Intergenic
1102033633 12:109758854-109758876 TGTGTTGAAATGGGGGAGCAAGG - Intronic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1102442933 12:112977567-112977589 CAAGATGTAGTGGGGGACCAGGG - Intergenic
1104769851 12:131354613-131354635 CATTATGAGCTGGGGCAGCCAGG + Intergenic
1104965037 12:132505198-132505220 CACGATGAAGTGGGTGAGCGCGG + Intronic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1106377737 13:29204937-29204959 CCAGATGATCTGGGGGACCAGGG + Intronic
1110793344 13:79609593-79609615 CATGATCAAGTGGGGATGCAGGG - Intergenic
1111195974 13:84874732-84874754 TCTGACGAACTGGGGGTGCAGGG - Intergenic
1112159377 13:96852012-96852034 CCTGATGAGCAAGGGGAGCAGGG + Intergenic
1113797009 13:113064290-113064312 CATTATGACCTGGAGGAGAAAGG - Exonic
1114339864 14:21731688-21731710 TATGGTGAAGTGGGGGAGAAAGG - Intergenic
1119124023 14:72107482-72107504 CAAAAAGAACTGGGGGAGCAGGG - Intronic
1119131362 14:72175966-72175988 GGTGGTGAACTTGGGGAGCAAGG - Intronic
1121572016 14:94953340-94953362 CTTGATGGAGTGGGGGAGGACGG - Intergenic
1123922159 15:25077807-25077829 CATGATGACCTTGGGGTGCTGGG + Intergenic
1123923988 15:25090587-25090609 CATGATGACCTCGGGGTGCTGGG + Intergenic
1124214686 15:27796814-27796836 GATGAGGAAAAGGGGGAGCATGG - Intronic
1124345638 15:28919765-28919787 CAGGATGACCTGGGGGAGCGGGG - Intronic
1124441968 15:29691968-29691990 CATGGGGTAGTGGGGGAGCATGG + Intergenic
1126704481 15:51394885-51394907 CATGGTGAACTGGGCCTGCAGGG + Exonic
1127202008 15:56664443-56664465 CATGGTGAACTGGGGGAGAAAGG + Intronic
1127662838 15:61116139-61116161 CAAGATGAATTGGGACAGCAGGG + Intronic
1129333384 15:74838972-74838994 CATGAGGAAGTGGGGGGGCAGGG - Intronic
1130092778 15:80835244-80835266 CATGGTGAATTGGGGGAACTTGG - Intronic
1130693464 15:86106338-86106360 CATGATATTCTGGGGGAGCATGG + Intergenic
1132311380 15:100860530-100860552 CATGAAGAGCTGGGGGTGGAGGG - Intergenic
1133843207 16:9428942-9428964 GCAGATGAACTGGGGGAGAAGGG + Intergenic
1135076234 16:19396135-19396157 TCTGATGAACTGGGGGTGCAGGG + Intergenic
1136370009 16:29830470-29830492 CAGGATGAACCTGGGGAGCCTGG - Exonic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1139547970 16:67658554-67658576 CCTGAGGAACTGGGTGAGGAAGG + Exonic
1142436202 16:90059406-90059428 CAGGATGAAGGTGGGGAGCATGG - Intronic
1143516854 17:7423752-7423774 CATGGTGAACTGGGGAAGGTGGG - Intergenic
1147654053 17:42078454-42078476 CATGGGGGACTGGGGGAGCAGGG + Intergenic
1150004652 17:61462398-61462420 CGAGGGGAACTGGGGGAGCATGG + Intronic
1150630247 17:66875460-66875482 CATGATCAACTGCTAGAGCAGGG + Intronic
1150708080 17:67506084-67506106 CATGATGATTTGAGGGAGGAGGG - Intronic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1153376559 18:4387149-4387171 GATGAAGAAATGAGGGAGCAAGG + Intronic
1154963991 18:21338491-21338513 AATGATAAACTGGAGTAGCAAGG - Intronic
1158531708 18:58268522-58268544 CATGATAAACTAGGGGTGAAGGG - Intronic
1159927060 18:74278979-74279001 CATGATGACCTTGGGGTACAGGG + Intronic
1160417210 18:78719808-78719830 CACAAAGAACTGGGGGAGCCTGG - Intergenic
1160502582 18:79409633-79409655 CATGATGGACGGGGGGTGAAGGG - Intronic
1160978939 19:1807590-1807612 CAGGGTGACCTGGGGAAGCAGGG - Intronic
1161235164 19:3194012-3194034 CATCAGCTACTGGGGGAGCAGGG + Intronic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1164121925 19:22273328-22273350 CATGATCAACTGAGCAAGCAGGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1166673937 19:44727813-44727835 CAGGATGAGCTGGGGGAGAGTGG - Intergenic
1167572933 19:50301296-50301318 CAGGATCATCTGGGGGAGCTTGG - Intronic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1168486211 19:56764654-56764676 CATGATGTGCTGGGTTAGCATGG - Intergenic
925702594 2:6653874-6653896 CATGAAGGGCTGGGGGAGGAAGG - Intergenic
926700503 2:15800217-15800239 TATGCTGACCTGGGGGAGCAGGG - Intergenic
928210207 2:29318439-29318461 TATCAGGAACTGGGGGACCAGGG + Intronic
929142395 2:38677622-38677644 CACAGTGAACAGGGGGAGCAGGG - Intronic
932179908 2:69637469-69637491 CATTATGAATTGGGAGATCAAGG - Intronic
932470745 2:71953811-71953833 GATGATGAACAGGTGTAGCATGG - Intergenic
933207300 2:79521850-79521872 CAGCATGAACTGGAGGGGCAGGG + Intronic
934092956 2:88570350-88570372 CTGGAAGAGCTGGGGGAGCAGGG - Intronic
935182647 2:100704433-100704455 CATGGTGCGCTGGGGGAGGAGGG + Intergenic
935410204 2:102753659-102753681 AATGAAGAACTGGCTGAGCATGG - Intronic
937060820 2:118979325-118979347 CATGATGAAGTGCGTGGGCATGG + Intronic
938750127 2:134320486-134320508 CTTTATGGACTGGGGGAGGAAGG + Intronic
938831612 2:135055475-135055497 CAAGAGGAGCTGGGGCAGCATGG + Intronic
944373753 2:199015384-199015406 CTTGATGAATTGGGGAGGCAGGG - Intergenic
945027127 2:205630121-205630143 CATGGAGAACTGGGGGAGGAGGG - Intergenic
947956999 2:234200903-234200925 CATGAGGAGCAAGGGGAGCAAGG + Intergenic
948113071 2:235472455-235472477 CATGATGAGCTGGAGTTGCAGGG - Intergenic
948133504 2:235619308-235619330 CATCATGAAGTGGGGGAGCTGGG + Intronic
949030848 2:241796641-241796663 CCTGATGGCCGGGGGGAGCAGGG + Intronic
1168927461 20:1594577-1594599 CATGAGGAACTGGGAGCCCATGG + Intronic
1170767744 20:19305235-19305257 CATGAGGAAATGTGGGAGGATGG + Intronic
1170854593 20:20039367-20039389 CAGGATGAACTGGGATATCATGG - Intronic
1174266853 20:49338169-49338191 CAGGAAGGACTGGCGGAGCAGGG + Intergenic
1174461844 20:50688865-50688887 CAGGATGAACTGGGGGACCCTGG + Intronic
1174585231 20:51603157-51603179 CTTTATCAGCTGGGGGAGCAGGG - Intronic
1175573993 20:60046757-60046779 CATGATGAATTGGAGTAGGAGGG - Intergenic
1175947077 20:62563940-62563962 CCTGATGAACGGGGGCTGCAGGG + Intronic
1179032185 21:37730285-37730307 CATAATGAACTTTGGGAGCCTGG + Intronic
1179426811 21:41286597-41286619 GATGATTAACTGGGGGAGACTGG - Intergenic
1183742664 22:39677467-39677489 CAGGAGGAACTGGGGGGGCGGGG + Intronic
1184488695 22:44796614-44796636 CATCACCAACTGGGGGAGCGAGG - Intronic
1184851833 22:47125348-47125370 CCTGGAGACCTGGGGGAGCAGGG + Intronic
949944673 3:9180487-9180509 CAAGATGAACTCGGGGAGCAGGG + Intronic
950193614 3:10993953-10993975 CATGAAGAGCTGGGGGGGCGGGG + Intronic
952428765 3:33201832-33201854 CAGGAAGAACAGGGGTAGCAAGG - Intronic
952838818 3:37627346-37627368 CATGATGAAGTGGAGTGGCAAGG - Intronic
952963292 3:38606140-38606162 CCTGAGGGTCTGGGGGAGCAAGG + Exonic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
953566343 3:44034935-44034957 CATGAGACACTGGGGGAGGAGGG - Intergenic
955020045 3:55111082-55111104 GATGATGAACTGGGGGCCTAGGG - Intergenic
957577729 3:82031338-82031360 CATGATACACAGGGGGTGCAGGG - Intergenic
957585290 3:82124816-82124838 CCTGCTTAACTGGGGGAACATGG - Intergenic
960222939 3:115136994-115137016 GATGATGAACTTGAGGAGAAAGG + Intronic
962724025 3:138204311-138204333 CATGAATAACTGAGGGAGAATGG - Intronic
967363812 3:188663118-188663140 CATGATGAACTGTGGGGGCTGGG + Intronic
967903054 3:194476880-194476902 CATGAGGAACTGGGGCGGAAGGG + Intronic
967997315 3:195176596-195176618 CATGAGGAACTGGAGAAGCTAGG - Intronic
968507399 4:977234-977256 CATGAGTAACTGCGGAAGCACGG + Intronic
973196542 4:47449437-47449459 CATGGTGGACTTGGGGAGGAAGG + Intergenic
981271895 4:142855172-142855194 CCTGATGACCTTGTGGAGCAGGG - Intergenic
981685909 4:147454706-147454728 CCTGATGCACTGAGGGTGCAAGG - Intergenic
982655546 4:158144688-158144710 CATGCTGAACTGGTGGATCTAGG - Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983660495 4:170126566-170126588 TCAGATGAACTGGGGGTGCAGGG + Intergenic
986112920 5:4738289-4738311 CATTGTGAATTGGAGGAGCATGG - Intergenic
987570480 5:19651638-19651660 CATGGTGAATTAGGGAAGCAAGG - Intronic
987864824 5:23525341-23525363 CAGGATGAAGGTGGGGAGCACGG + Intronic
990358667 5:54996299-54996321 CATGGGGAGCTGGGGCAGCAGGG - Intronic
991003473 5:61805639-61805661 CATCATGAACTGGGGCAGGCTGG + Intergenic
991254989 5:64603758-64603780 GATGATGAGCTGGGGCAGCCGGG + Intronic
996818802 5:127602709-127602731 CATGAAGGTTTGGGGGAGCAGGG - Intergenic
999647687 5:153735381-153735403 CATGATCAACTGAGCAAGCAGGG + Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1002835371 6:861065-861087 GAAGATGAATTGGGGGAACATGG + Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1003869255 6:10389029-10389051 CATGATGATCAAGGGGAGGAAGG - Intergenic
1004205470 6:13587853-13587875 GAAGGTGAACTGGGGGAGGAAGG + Intronic
1005824794 6:29626467-29626489 CATGAATAATTGGGGGTGCAGGG - Intronic
1005969377 6:30749297-30749319 CATGGTGATCTGGGGGAAGATGG - Intergenic
1006495112 6:34417198-34417220 CATGCTGAGCTGAGGCAGCATGG + Intronic
1008222963 6:48876796-48876818 TCTGATGAACTGGGGGTGCAGGG - Intergenic
1008625240 6:53309261-53309283 CATATTGAACTGGGGCAGTATGG + Intronic
1010376461 6:75176262-75176284 CGTGATGCAGTGGGGGAGGAAGG + Intronic
1010376509 6:75176463-75176485 CATGACGCAGTGGGGGAGGAGGG + Intronic
1012843033 6:104354471-104354493 CCTGATGAACGAGAGGAGCAAGG - Intergenic
1015650529 6:135452879-135452901 GATGATGAACTGTGGGGTCAGGG - Intronic
1016004018 6:139070869-139070891 CATGATGAAGTGAGGGATTAAGG + Intergenic
1016320527 6:142839640-142839662 CCTGGTGAACTCAGGGAGCATGG - Intronic
1017219050 6:151944480-151944502 CATGATCAACTGGGCGAAGAGGG + Exonic
1018253658 6:161896628-161896650 CGGGAGGAGCTGGGGGAGCAGGG + Intronic
1018352303 6:162972614-162972636 CATGTGGAACTGGGGGATGAGGG - Intronic
1018698653 6:166410191-166410213 TATGATGAACTGTGTGAGGAAGG + Intronic
1019053463 6:169202260-169202282 CAGGTGGACCTGGGGGAGCAGGG + Intergenic
1019523192 7:1469604-1469626 CATGGGGAACCGGGAGAGCACGG + Intergenic
1022115697 7:27258642-27258664 CAGGATCACCTGGGGGAGCTTGG - Intergenic
1023793347 7:43771038-43771060 CAGGAAGCAGTGGGGGAGCATGG + Intronic
1024063703 7:45716525-45716547 CACGGTGAGCTGGGGGAGCCAGG - Exonic
1025249637 7:57343353-57343375 CATTATGGAGTGGGGGAGGAAGG - Intergenic
1025784524 7:64632517-64632539 CATGATGACCTCTGTGAGCAGGG - Intergenic
1032156115 7:129469675-129469697 CAAGATAACCTGGGGGACCAGGG - Intronic
1033356887 7:140607377-140607399 AACCATGAGCTGGGGGAGCAAGG + Intronic
1033558092 7:142506622-142506644 CATGAGGGACTTGGGGAGAAAGG - Intergenic
1038408848 8:27342663-27342685 CGGGATGAACTGGGGGTGCTGGG - Intronic
1040122286 8:43696583-43696605 TCTGATGAACTGGGGATGCAAGG + Intergenic
1040138696 8:43885039-43885061 TCTGATGAACTGAGGGTGCAGGG + Intergenic
1040602697 8:48899673-48899695 CATGAGGAAATTGGGGAGCCTGG - Intergenic
1040972776 8:53155171-53155193 CATGATAAACTTAGGGAGAAGGG - Intergenic
1042774846 8:72419221-72419243 CATGAAGGGTTGGGGGAGCATGG - Intergenic
1043994700 8:86798737-86798759 CATGTGGTACTGGTGGAGCAGGG - Intergenic
1045009188 8:97943151-97943173 CCTAAAGAACTGGGGGAGCCTGG + Intronic
1045400642 8:101813392-101813414 CATGATGAACTGGGCAAACATGG + Intronic
1045448069 8:102288205-102288227 CATGATGAACAGGAAGAACACGG - Exonic
1045687975 8:104731272-104731294 GATGAGGAACTGGGGTACCATGG - Intronic
1046604752 8:116358943-116358965 CATGATAAACTTTGGTAGCATGG - Intergenic
1048294909 8:133206938-133206960 CCTGATCAACTGGAGGTGCATGG - Intronic
1049254544 8:141606673-141606695 CCTGACGAACGGGGGGAGCTGGG + Intergenic
1049708812 8:144054628-144054650 CATGGTGGAGTGGGGGGGCATGG + Exonic
1049876945 8:145030157-145030179 TCTGATGAACTGGGGGTGAAGGG - Intergenic
1052254420 9:26437474-26437496 CATAAAGAACTGGAGGAGAAGGG + Intergenic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1056722708 9:89085430-89085452 CATGGGGAACTGCGAGAGCACGG - Intronic
1056740906 9:89254858-89254880 CGTGATGATCTTGGGGAGGATGG - Intergenic
1060033725 9:120237096-120237118 AATGACCAACTGGGAGAGCAGGG - Intergenic
1060180469 9:121530094-121530116 AAAGATGGACTGGGGGAGAAGGG + Intergenic
1060742208 9:126106698-126106720 CATGAAGAACTGGAGGTTCACGG - Intergenic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061202797 9:129147233-129147255 AGTGAGGAACTGGGGGAGGAAGG + Intronic
1062312743 9:135948033-135948055 CTTGATGAGCTGGGGGAGCCTGG + Intronic
1062335835 9:136066804-136066826 AATGAAGTACTGGGAGAGCACGG + Intronic
1187102640 X:16210489-16210511 AATGATAAAATGGGAGAGCAGGG - Intergenic
1189101003 X:38189672-38189694 AAAGATAAACTGGGGGAGCTAGG - Intronic
1190281668 X:48935096-48935118 GAGGAGGAACTGGGGGACCAGGG + Intronic
1190362561 X:49662830-49662852 CATGATGAACTGGATGAAGATGG - Intergenic
1193889806 X:87031360-87031382 AATGGTGAAGTGGGGGAGAAGGG - Intergenic
1194166965 X:90529043-90529065 CAAGATAAACTGGGGGATCCTGG - Intergenic
1197313573 X:124936190-124936212 CATGATGAAGTTGGGGAGTCAGG - Intronic
1198443134 X:136684218-136684240 AGAGAAGAACTGGGGGAGCATGG - Intronic
1198469293 X:136931015-136931037 CATGATAAATTGGGCAAGCATGG + Intergenic
1198558837 X:137826094-137826116 CATGATGAACTGGAGGAAGCAGG + Intergenic
1198870946 X:141176815-141176837 CACGATAAACTCGGGGAGCCGGG + Exonic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200272495 X:154699106-154699128 CATGACAATCTGGGGCAGCAAGG + Intronic
1200286762 X:154830173-154830195 CATTAGCAACTGGGGGAGGAAGG + Intronic
1200513232 Y:4106819-4106841 CAAGATAAACTGGGGGATCCTGG - Intergenic
1200961263 Y:8998199-8998221 TCTGATGAACTGGGGGTGCAGGG - Intergenic
1200982625 Y:9276253-9276275 TCTGATGAACTGGGGGTGTAGGG + Intergenic
1201400649 Y:13600552-13600574 CATGATGGACTGAGCAAGCATGG + Intergenic
1202127770 Y:21583448-21583470 TCTGATGAACTGGGGGTGTAGGG - Intergenic
1202151510 Y:21848032-21848054 TCTGATGAACTGGTGGTGCAAGG + Intergenic