ID: 953412975

View in Genome Browser
Species Human (GRCh38)
Location 3:42700739-42700761
Sequence GGCCCCGGCCAGCATAGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953412963_953412975 22 Left 953412963 3:42700694-42700716 CCACCTGCCCCGGGGCACAGCCA 0: 1
1: 0
2: 7
3: 51
4: 433
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412968_953412975 2 Left 953412968 3:42700714-42700736 CCATTACCTTGTGAAGCCTCAAG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412966_953412975 14 Left 953412966 3:42700702-42700724 CCCGGGGCACAGCCATTACCTTG 0: 1
1: 0
2: 5
3: 18
4: 153
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412964_953412975 19 Left 953412964 3:42700697-42700719 CCTGCCCCGGGGCACAGCCATTA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412965_953412975 15 Left 953412965 3:42700701-42700723 CCCCGGGGCACAGCCATTACCTT 0: 1
1: 0
2: 0
3: 6
4: 150
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412971_953412975 -4 Left 953412971 3:42700720-42700742 CCTTGTGAAGCCTCAAGGAGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412962_953412975 27 Left 953412962 3:42700689-42700711 CCTGTCCACCTGCCCCGGGGCAC 0: 1
1: 0
2: 1
3: 42
4: 311
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254
953412967_953412975 13 Left 953412967 3:42700703-42700725 CCGGGGCACAGCCATTACCTTGT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953412975 Original CRISPR GGCCCCGGCCAGCATAGGCC AGG Exonic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
900331074 1:2134930-2134952 GGACCCGGCCTGCGTTGGCCTGG + Intronic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
900665846 1:3815051-3815073 GGCCACGGTCAGCACAGGCACGG - Exonic
901319212 1:8329590-8329612 GGCACCGGCCAGCCCAGCCCTGG - Intronic
901650159 1:10738506-10738528 AGCCACTGCCAGGATAGGCCAGG + Intronic
901786837 1:11630228-11630250 GGCCCCTGACAGCATAGGGCTGG - Intergenic
901925425 1:12563267-12563289 AGCCCCTCCCATCATAGGCCTGG + Intergenic
902169674 1:14599453-14599475 GGCCCCGGCCAGCCTGAGCGAGG + Intronic
903017436 1:20370138-20370160 GCCCTTGGCCAGCATGGGCCTGG - Intergenic
903647236 1:24902799-24902821 GGCCCCGGGCAGCCTAGGGCAGG - Intronic
904743262 1:32694949-32694971 GACCCCTGCAAGCAGAGGCCCGG - Exonic
905483108 1:38275201-38275223 GGCCCAGGCCCGGAGAGGCCAGG + Intergenic
908703954 1:66930473-66930495 GGGCCTGGCCAGGAGAGGCCCGG + Intronic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
909369024 1:74862252-74862274 AGCCCCTCCCATCATAGGCCTGG - Intergenic
910275937 1:85449208-85449230 GGCACAGGCCAGCATAAGGCAGG + Intronic
912136141 1:106662409-106662431 AGCCCCTCCCATCATAGGCCTGG + Intergenic
914490381 1:148147477-148147499 GGCCCAGGCAAGCACAGGGCTGG - Intronic
914961583 1:152213998-152214020 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914961654 1:152214394-152214416 GGCCACGGCCAACATGGGTCTGG - Exonic
914961831 1:152215408-152215430 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914961903 1:152215804-152215826 GGCCACGGCCAACATGGGTCTGG - Exonic
914962078 1:152216818-152216840 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962148 1:152217214-152217236 GGCCACGGCCAACATGGGTCTGG - Exonic
914962328 1:152218228-152218250 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962399 1:152218624-152218646 GGCCACGGCCAACATGGGTCTGG - Exonic
914962452 1:152218933-152218955 GGCCACGGCCAGCGTGGGTCTGG - Exonic
914962692 1:152220334-152220356 GGCCACGGCCAGCGTGGGTCTGG - Exonic
915090057 1:153417860-153417882 GGCCCTGGCCAGGATGGGCCGGG + Intronic
915095427 1:153459216-153459238 GGCCCTGGCCAGGATGGGCCAGG - Intronic
915282480 1:154832022-154832044 TGCCCCTGTAAGCATAGGCCGGG - Intronic
915303102 1:154962457-154962479 GGCCCGGCCCAGCCTAGGCCCGG - Exonic
915740741 1:158116571-158116593 GGCCCCCCCCAGCACAGACCAGG - Intergenic
917195279 1:172457667-172457689 GGCCAAGGCCAGCTTAGGCCTGG - Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
920376833 1:205513309-205513331 GGCAAGGGCCAGGATAGGCCTGG - Intronic
922802310 1:228370107-228370129 GGCCCCGGGCAGGAGAAGCCTGG - Intronic
1062948697 10:1479426-1479448 GGGCCCGGACAGCAGAGGCTGGG + Intronic
1064245674 10:13666032-13666054 GGCCCCGGCAACCAGACGCCAGG - Intronic
1066064224 10:31750526-31750548 GGCCCCGGCCAGCTCAGGGGAGG + Intergenic
1067183998 10:44011824-44011846 AGCTCCAGCCAGCACAGGCCTGG + Intergenic
1067227793 10:44386665-44386687 GGCCCAGCCCAGCAAAGGCCTGG - Intergenic
1067797127 10:49328695-49328717 GGCCCTGGGCAGCATAGTCCTGG - Intergenic
1068243510 10:54336377-54336399 AGCCCCTCCCATCATAGGCCAGG + Intronic
1070877298 10:79826097-79826119 CGCCCCGGCGAGAACAGGCCCGG + Intergenic
1071527345 10:86366274-86366296 GCCCCCGCCCAGCCTCGGCCCGG + Intronic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1071643795 10:87342141-87342163 CGCCCCGGCGAGAACAGGCCCGG + Intergenic
1072769423 10:98125118-98125140 AGCCCCTGCCATCACAGGCCTGG - Intergenic
1073468152 10:103706397-103706419 GGCCCAGGACAGCATTGGTCCGG - Intronic
1076726855 10:132417997-132418019 GGCCCCGCCCAGCAGTGCCCAGG - Intergenic
1076752094 10:132548369-132548391 GGCAACGGGCAGCAGAGGCCTGG - Intronic
1077402936 11:2367939-2367961 GACCCTGGCCAGAAAAGGCCGGG + Intergenic
1077537267 11:3130394-3130416 GGCCCCCCCCAGCAAAGCCCAGG - Intronic
1078069161 11:8097084-8097106 GGGCCTGGCCAGCCTGGGCCTGG - Intronic
1079101443 11:17544448-17544470 GGCCCCGCCCCACAGAGGCCTGG - Intergenic
1082001315 11:47395040-47395062 GGCCCTCGCCAGCCTGGGCCAGG + Intergenic
1084095057 11:66905851-66905873 GGCCCTGGCGAGCTTAGCCCAGG + Intronic
1084171707 11:67404190-67404212 GGCCCCGGGCACCATGGCCCAGG + Exonic
1085051792 11:73383782-73383804 GGGCCCGGCCTGCACAGGGCTGG + Intronic
1085524180 11:77154800-77154822 GGTCCAGGCCAGCCAAGGCCAGG + Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089590921 11:119540324-119540346 GCCCCTGGTCAGGATAGGCCTGG - Intergenic
1089800616 11:121024166-121024188 GGTCCCGGCCAGCCCCGGCCCGG - Exonic
1090854458 11:130599320-130599342 GGCCCCAGCCATCAAAGGCCTGG - Intergenic
1091451591 12:575561-575583 GCCCAAGGCCAGCACAGGCCAGG - Intronic
1092643089 12:10537968-10537990 AGCCCCTCCCATCATAGGCCCGG - Intergenic
1092879761 12:12878907-12878929 TGTACCTGCCAGCATAGGCCAGG - Intergenic
1094473355 12:30823247-30823269 GGCCCCTGCCGGCATTGGCCAGG + Intergenic
1095516814 12:43015527-43015549 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1097501588 12:60410212-60410234 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1098777904 12:74644995-74645017 GGCACAGGCCAGCATTGGCAAGG - Intergenic
1099932602 12:89091438-89091460 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1100176874 12:92040765-92040787 GGCACTGGCCACCATAGGCTTGG + Intronic
1101358971 12:104008686-104008708 TGCCCCTGCCATCACAGGCCCGG + Intronic
1101683013 12:106987312-106987334 TGCCCCCGCCAGCACAGGCTGGG - Intergenic
1102204195 12:111078971-111078993 GGACCAGGCCAGGATAGGCTTGG - Intronic
1103592837 12:122004442-122004464 AGCCCCGCCCAGCAGAGGCCGGG + Intergenic
1106517100 13:30465213-30465235 GGGCCCGGCCGGCCTCGGCCCGG - Intronic
1106603386 13:31206373-31206395 TGCCTGGGCCACCATAGGCCCGG + Intronic
1107696011 13:43000991-43001013 GCCCCTGGCCTGCATATGCCCGG - Intergenic
1109962074 13:69644587-69644609 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1110496561 13:76174444-76174466 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1112252908 13:97800477-97800499 GGCTTCGGCCAGCAGAGGGCAGG - Intergenic
1117198550 14:53364497-53364519 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1120342898 14:83244933-83244955 GCCCCCTGCCATCATAGGCCTGG + Intergenic
1121063492 14:90938829-90938851 AGCCCCTCCCATCATAGGCCTGG - Intronic
1121074956 14:91060300-91060322 GGGCCCGGCCGGCAGAGGGCGGG + Intronic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1122514474 14:102297602-102297624 GGCCCCGGCCAGCCCAGGGAGGG - Intronic
1122658467 14:103278963-103278985 GACCCCCGCCAGCCTTGGCCCGG - Intergenic
1123031132 14:105451682-105451704 GTCCCCGGCAAGCATGGACCCGG - Intronic
1123056102 14:105571547-105571569 TGCCCCGGCCAGCACAGACGGGG - Intergenic
1123080537 14:105691678-105691700 TGCCCCGGCCAGCACAGACGGGG - Intergenic
1123082106 14:105700182-105700204 TGCCCCGGCCAGCACAGACGGGG + Intergenic
1124249115 15:28095992-28096014 GGCCCCTGCAAGCATAGCCAGGG - Intronic
1125279224 15:38026690-38026712 AGCCCCTGCCATCACAGGCCTGG + Intergenic
1129038990 15:72669957-72669979 GGCCTCTGTCAGCATAAGCCTGG + Intergenic
1129210844 15:74066963-74066985 GGCCCCTGTCAGCATAAGCCTGG - Intergenic
1129399504 15:75273809-75273831 GGCCTCTGTCAGCATAAGCCTGG + Intronic
1129403167 15:75298366-75298388 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1129476649 15:75790491-75790513 GGCCCTTGTCAGCATAAGCCTGG + Intergenic
1130259023 15:82339635-82339657 GGCCCCTGTCAGCATAAGCCTGG - Intergenic
1130269652 15:82439485-82439507 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1130282276 15:82529925-82529947 GGCCCCTTCCAGCATAAGCCTGG + Intergenic
1130461993 15:84166783-84166805 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1130473612 15:84245705-84245727 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1130481027 15:84359769-84359791 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1130490685 15:84427990-84428012 GGCCCCTGTCAGCATAAGCCTGG - Intergenic
1130502272 15:84506760-84506782 GGCCCCTGTCAGCATAAGCCTGG - Intergenic
1130595896 15:85250306-85250328 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1130651801 15:85766332-85766354 GGCCCAGGACAGCATGAGCCGGG + Intronic
1136011139 16:27364006-27364028 GACCCCGCCCAGCATTGGGCTGG + Exonic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1139378670 16:66516593-66516615 GGACTCTGCCAGTATAGGCCCGG - Intronic
1140469333 16:75205712-75205734 GGCCCCGTGCAGCAGAGGGCAGG - Intronic
1140472451 16:75223227-75223249 GGCCCCGTGCAGCAGAGGGCAGG + Intronic
1142007357 16:87695831-87695853 GGCCCCGGCAAGCACAGGGAAGG + Intronic
1142147442 16:88498498-88498520 TGCTCAGGCCAGCATAGCCCAGG + Intronic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1144495358 17:15742070-15742092 CGCCCTGGCCCCCATAGGCCAGG + Intronic
1144640460 17:16933922-16933944 GGGCCTGGCTAGCAGAGGCCTGG - Intronic
1149341080 17:55687183-55687205 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1150515679 17:65807517-65807539 AGCCCCTCCCACCATAGGCCTGG + Intronic
1151249755 17:72825107-72825129 AGCCCCTTCCATCATAGGCCTGG + Intronic
1151478459 17:74356530-74356552 GGCGCCGGCCACCCTAGGGCTGG - Exonic
1152573923 17:81131988-81132010 GGCCCCGTGCAGCCTAGGGCTGG + Intronic
1154416280 18:14177685-14177707 GGCCTCGGGCAGTATAGCCCCGG - Intergenic
1157625293 18:49045755-49045777 GGCCCCGCACAGGAAAGGCCTGG + Intronic
1160803042 19:979392-979414 TGTCCCGGCCAGCCTCGGCCAGG - Intergenic
1160806496 19:994417-994439 GGCCCCCACCAGCCCAGGCCTGG + Exonic
1161219779 19:3113229-3113251 CGCCCGGGCCAGCCGAGGCCTGG + Intronic
1161224401 19:3136390-3136412 TGCCCTGGCCAGCAGGGGCCCGG + Exonic
1161300372 19:3539551-3539573 GGCCCAGCCCCGCACAGGCCTGG - Intronic
1161505220 19:4640046-4640068 GGCCCGGGCTGGCCTAGGCCTGG - Exonic
1162299265 19:9835112-9835134 GCCCCCGGCCAGCCTCAGCCTGG - Intergenic
1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG + Exonic
1162918343 19:13886012-13886034 GGGCCCGGCCAGCAAGGGCCCGG + Exonic
1163038073 19:14583208-14583230 GGCCCCGGCCAGGCTGGGGCTGG + Intronic
1163863141 19:19752955-19752977 GGCCCTGGTCAGCAGGGGCCTGG - Intergenic
1164620723 19:29694706-29694728 GGTCCCGGCCAGGCCAGGCCAGG - Intergenic
1165006912 19:32814845-32814867 GGCCCCAGCCAGGGCAGGCCTGG + Intronic
1165363840 19:35352076-35352098 GGGCCGGGCCGGCAGAGGCCGGG - Exonic
1165394763 19:35558193-35558215 GGCCCCGTCCACCAGAGGCAAGG - Intronic
925261199 2:2530045-2530067 TGCTCCAGCCAGCACAGGCCAGG + Intergenic
926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG + Exonic
927720273 2:25377878-25377900 GCCCCCGGCCAGCAGAGCGCAGG + Intronic
927856791 2:26532745-26532767 TGCCCCGGCCAGCACCAGCCAGG - Intronic
928080685 2:28309811-28309833 GGCCCAGGCCAACATAGCTCGGG + Intronic
929687080 2:44044430-44044452 GGCTACTGCCAGCAGAGGCCGGG - Intergenic
934710134 2:96509007-96509029 GACCCGGGGAAGCATAGGCCTGG - Intergenic
936341568 2:111638316-111638338 GGCCCAAGCCAGCAGAGCCCTGG + Intergenic
937092956 2:119218585-119218607 AGCCCAGCCCAGCATAGGCAAGG - Intergenic
937280023 2:120711331-120711353 GGCCTAGGCCAGCATGGGGCGGG + Intergenic
937995469 2:127690918-127690940 AGCCCCTCCCAGCACAGGCCTGG - Intergenic
938018304 2:127885709-127885731 CGCCCCGGCGAGAACAGGCCCGG + Intronic
938422703 2:131156981-131157003 GGGCCTGGCCAGCAGAGGGCTGG - Intronic
942203297 2:173593328-173593350 GGCCCCTCCCATCACAGGCCTGG - Intergenic
942251593 2:174051877-174051899 GGCCCCACCCAGCTTGGGCCAGG - Intergenic
942283336 2:174389692-174389714 AGCCCCTCCCATCATAGGCCTGG + Intronic
942748578 2:179264187-179264209 GGCCGCGGCCCGCAGAGACCGGG - Intronic
944413180 2:199461949-199461971 CGCTCCGGACAGCGTAGGCCTGG + Intronic
945073588 2:206015317-206015339 AGCCCCTCCCATCATAGGCCTGG + Intronic
947728857 2:232417247-232417269 GGCCCGGGTCAGCCTGGGCCAGG - Intergenic
1169213073 20:3778368-3778390 GCTCGCGGCCAGCAGAGGCCGGG - Intronic
1170875327 20:20244608-20244630 AGCCCCTCCCATCATAGGCCTGG - Intronic
1170928074 20:20744019-20744041 GGCCCTGGCCACCACAGACCCGG + Intergenic
1171421823 20:25022803-25022825 GGCCCTGCCCCGAATAGGCCAGG + Intronic
1172516954 20:35541868-35541890 CGCCCCGGACAGCGGAGGCCGGG + Intergenic
1172600599 20:36180073-36180095 AGCCCCTGCCAGCACAGCCCAGG + Intronic
1172705165 20:36877679-36877701 GGCCCCTGCCAGCTGAGGGCTGG - Intronic
1173249006 20:41354763-41354785 GGCCAGGGCCAGCACAGGGCGGG + Intronic
1173546737 20:43903655-43903677 AGCCCCTGCCAGGTTAGGCCCGG - Intergenic
1173880302 20:46406631-46406653 GACCCCGCCCCGCACAGGCCGGG + Intronic
1174295445 20:49542209-49542231 GGCCAGGGCCAACACAGGCCAGG + Intronic
1175732330 20:61362356-61362378 GGCCTAGGACAGCATAGGGCAGG + Intronic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1178143916 21:29716894-29716916 AGCCCCTCCCATCATAGGCCTGG + Intronic
1178493869 21:33071011-33071033 GGTCCCGGCCAGCCTGGGCCTGG + Exonic
1179270618 21:39847916-39847938 GGCCCCGCCCGGCTTAGGACTGG + Intergenic
1179492234 21:41748137-41748159 GACACCGGCCAGCAGAGGCCTGG + Intronic
1179499284 21:41796909-41796931 GGCCCCGGCCAGCTTTGTCCGGG + Intergenic
1180109924 21:45643039-45643061 CGCCCCGCCCACCACAGGCCTGG + Intergenic
1180214325 21:46314954-46314976 GGCTCAGGCCAGCCTGGGCCAGG + Intronic
1181027439 22:20134112-20134134 GGCAGAGGTCAGCATAGGCCAGG - Intronic
1181038318 22:20180313-20180335 GGCCCTGGCCCTCATGGGCCAGG + Intergenic
1182013613 22:27020933-27020955 GAACCCGGCCAGGACAGGCCGGG + Intergenic
1183329354 22:37211257-37211279 GGCACTGGCAAGCATAAGCCAGG - Intronic
1183988016 22:41579961-41579983 GCCCCCTGCCAGCCTTGGCCTGG + Intronic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
952898883 3:38096755-38096777 TGCCTCGGCCAGCCTAGGCAGGG - Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
956880591 3:73507311-73507333 GGCACCTGCCACCATATGCCTGG + Intronic
960936071 3:122903436-122903458 GGCCCCAGTGAGCACAGGCCTGG + Intergenic
962731779 3:138290176-138290198 GGCCCTGGCCAGACCAGGCCAGG - Intronic
963011716 3:140776128-140776150 GGCCCCTTCCATCACAGGCCTGG - Intergenic
963363274 3:144303483-144303505 AGCCCCTGCCATCACAGGCCTGG - Intergenic
967930418 3:194686731-194686753 GGCCCCTGCCAGGCTCGGCCCGG - Exonic
968441530 4:626862-626884 GGCAGCGGCCAGCAGAGACCTGG + Intronic
968455961 4:699963-699985 GGCCCCAGCCAGAGAAGGCCTGG + Intergenic
968508349 4:982761-982783 GGACCCGGCCACGACAGGCCAGG - Intronic
968590503 4:1456643-1456665 GGCCCCTCCCATCACAGGCCTGG - Intergenic
970326361 4:14928953-14928975 GGCCCTGGACAGAATAGGCATGG - Intergenic
970461230 4:16276960-16276982 AGCCCCTGCCATCACAGGCCTGG + Intergenic
972857161 4:43120696-43120718 AGCCCCTTCCATCATAGGCCCGG - Intergenic
974923499 4:68270461-68270483 AGCCCCTTCCATCATAGGCCTGG - Intergenic
980266583 4:130524271-130524293 AGCCCCTCCCATCATAGGCCTGG - Intergenic
980407087 4:132366858-132366880 AGCCCCTGCCATCAAAGGCCTGG - Intergenic
980739206 4:136928948-136928970 GGCCTCGGCCAGCCTAGGGAGGG - Intergenic
983669039 4:170215037-170215059 AGCCCCTTCCATCATAGGCCTGG + Intergenic
984065539 4:175043663-175043685 GGCCCCTCCCATCCTAGGCCTGG + Intergenic
986105560 5:4656156-4656178 AGCCCCTCCCATCATAGGCCTGG - Intergenic
988009555 5:25464866-25464888 AGCCCCTGCCATCACAGGCCGGG + Intergenic
989379261 5:40797877-40797899 CGGCGCGGCCAGCACAGGCCGGG - Intronic
989731387 5:44654178-44654200 AGCCCCTCCCATCATAGGCCTGG - Intergenic
994353807 5:98773731-98773753 GGCCCCAGCCAGCGTGGGCTCGG - Intronic
998545448 5:143023647-143023669 GCCACCGACCAGCAGAGGCCTGG - Intronic
1000226473 5:159266638-159266660 AGCCCCTCCCAGCACAGGCCCGG + Intronic
1001452117 5:171834964-171834986 GGCCACAGCCAGAATTGGCCTGG - Intergenic
1002898896 6:1394298-1394320 GGCTCAGGGCAGCACAGGCCAGG + Intronic
1005655313 6:27929360-27929382 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1008650047 6:53552688-53552710 AGCCCCTTCCACCATAGGCCTGG + Intronic
1009792336 6:68419858-68419880 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1011867908 6:91854279-91854301 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1011876225 6:91965795-91965817 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1012830758 6:104201362-104201384 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1013086595 6:106863003-106863025 GGCCCCTCCCATCACAGGCCTGG + Intergenic
1013829583 6:114255853-114255875 AGCCCCTCCCAGCACAGGCCTGG - Intronic
1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG + Intergenic
1014525935 6:122501685-122501707 AGCCCCTTCCATCATAGGCCTGG - Intronic
1016291667 6:142534664-142534686 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1016649645 6:146448737-146448759 AGCCCCTGCCATCACAGGCCTGG - Intergenic
1017654489 6:156614226-156614248 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1018516158 6:164581810-164581832 AGCCCCGTCCATCACAGGCCTGG - Intergenic
1019497424 7:1346945-1346967 GCCCCCGGCCAGCATGGGATAGG - Intergenic
1022097954 7:27152467-27152489 AGCCCCGGCCAGGCCAGGCCTGG - Intronic
1023861451 7:44219771-44219793 GGCCCCGGGCAGCACAGTCCTGG - Intronic
1023863448 7:44228221-44228243 AGCCCAGGTCAGCAGAGGCCAGG + Intronic
1023863910 7:44229818-44229840 GGCCAGAGCCAGCAGAGGCCAGG + Intronic
1026220468 7:68392127-68392149 GGCTCCGGCCACCAGTGGCCTGG - Intergenic
1027188864 7:75986660-75986682 GGCCCCTGGCAGCACAGCCCAGG + Exonic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1030415432 7:109237996-109238018 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1032179261 7:129661220-129661242 AGCCCCTCCCATCATAGGCCTGG - Intronic
1032392820 7:131567158-131567180 GGCTCAGGCCAGAATAGGCTAGG - Intergenic
1032453998 7:132058183-132058205 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1033706026 7:143885433-143885455 GCCCCCGGACCGCAGAGGCCCGG + Intronic
1044326866 8:90868908-90868930 AGCCCCTCCCATCATAGGCCTGG + Intronic
1044945451 8:97384787-97384809 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1045207361 8:100056462-100056484 AGCCCCTCCCATCATAGGCCTGG + Intronic
1045422203 8:102027099-102027121 AGCCCCTGCCATCAAAGGCCTGG - Intronic
1048402646 8:134086409-134086431 GGACCTGGCCAGCAAAGCCCAGG + Intergenic
1049411532 8:142475820-142475842 GGCCCCGCCCAGCGTCTGCCAGG - Intronic
1049655477 8:143795159-143795181 GCACCCGGCCAGCACAGGGCAGG + Intronic
1049670908 8:143869461-143869483 GGCCAAGGCCAGCATCGCCCAGG - Exonic
1052756802 9:32550635-32550657 GGCCCTGGCCCGCCGAGGCCCGG + Intronic
1053352841 9:37424751-37424773 GGCCAGGGCCATCAGAGGCCAGG + Intronic
1053481468 9:38419567-38419589 GGTCCCGGCCAGCACCCGCCAGG - Intronic
1053882706 9:42611742-42611764 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1053889963 9:42682560-42682582 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1054221733 9:62419210-62419232 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1054228981 9:62489963-62489985 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1054744842 9:68843892-68843914 GGGCCCTGCCAACATGGGCCTGG + Intronic
1056413490 9:86354604-86354626 GGCGCCGGACAGGAGAGGCCAGG - Intergenic
1057305965 9:93912211-93912233 GGCCCAGGCCAGGATGGGGCTGG + Intergenic
1057571058 9:96204398-96204420 GGCCCAGGCCTGCCTAGCCCTGG - Intergenic
1059389348 9:113989017-113989039 GGCCCAGGCCAGAAGAGGCAGGG - Intronic
1060778455 9:126393775-126393797 GGCCCCTGCCAGCCCTGGCCAGG - Intronic
1061219442 9:129241819-129241841 GGCCAGGGCCTGCATGGGCCAGG - Intergenic
1061231759 9:129319669-129319691 GGCCCCGGCCTCCACGGGCCCGG - Intergenic
1061672123 9:132194626-132194648 GGCCCGGGCCAGGGTAGGACTGG - Intronic
1061922743 9:133791148-133791170 GGCTCCGGTCAGCACAGACCAGG + Intronic
1062525041 9:136974796-136974818 GGCCCCGGCCAGCATCCTCCGGG - Intergenic
1062616996 9:137401800-137401822 AGCCCCTCCCATCATAGGCCTGG - Intronic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1190335923 X:49261603-49261625 GGCCCCGGACTCCATAGGTCAGG - Intronic
1192335575 X:70216758-70216780 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1193996025 X:88366552-88366574 AGCCCCAACCATCATAGGCCTGG - Intergenic
1194205088 X:91002742-91002764 GTCCCCGGGCAGAAGAGGCCTGG - Intergenic
1194944138 X:100048367-100048389 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1196782901 X:119399302-119399324 GGCCCCGCCCGGCATGGGGCGGG - Exonic
1197092517 X:122556026-122556048 GGCTCCTCCCATCATAGGCCTGG + Intergenic
1198274620 X:135089268-135089290 AGCCCCTCCCATCATAGGCCTGG + Intergenic
1199027942 X:142961434-142961456 AGCCCCTCCCATCATAGGCCTGG - Intergenic
1200117222 X:153774653-153774675 GGCCGGGGCCAGCATCAGCCAGG - Intronic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic
1200142194 X:153907824-153907846 GGCCCCGCCCAGCAGCCGCCTGG - Exonic
1202367551 Y:24177564-24177586 GGCCCCTGTCAGCATACGCCTGG + Intergenic
1202377284 Y:24248369-24248391 GGCCCCTGTCAGCATAAGCCTGG - Intergenic
1202493496 Y:25421752-25421774 GGCCCCTGTCAGCATAAGCCTGG + Intergenic
1202503232 Y:25492559-25492581 GGCCCCTGTCAGCATACGCCTGG - Intergenic