ID: 953415188

View in Genome Browser
Species Human (GRCh38)
Location 3:42711727-42711749
Sequence CTCATTTTACGGATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953415181_953415188 8 Left 953415181 3:42711696-42711718 CCATGGGGGACTGAATTATAAAT 0: 1
1: 0
2: 0
3: 15
4: 164
Right 953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 137
953415175_953415188 27 Left 953415175 3:42711677-42711699 CCCTACTGGAGTGAGACTGCCAT 0: 1
1: 0
2: 1
3: 6
4: 97
Right 953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 137
953415174_953415188 28 Left 953415174 3:42711676-42711698 CCCCTACTGGAGTGAGACTGCCA 0: 1
1: 0
2: 1
3: 12
4: 195
Right 953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 137
953415176_953415188 26 Left 953415176 3:42711678-42711700 CCTACTGGAGTGAGACTGCCATG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953415188 Original CRISPR CTCATTTTACGGATGGGCCA GGG Intronic
900576438 1:3384869-3384891 CTCATTTTATCGCCGGGCCAGGG + Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902533188 1:17103529-17103551 CCCATTTTACAGATAGACCAAGG + Intronic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
905368660 1:37470758-37470780 CTGATTTTAGGGCTGGGACAGGG - Intergenic
906830980 1:49031573-49031595 CTCAGTTTAAGAATGGGCAAAGG + Intronic
909120196 1:71593569-71593591 CACATTTTAGGAATGTGCCATGG + Intronic
909906067 1:81196648-81196670 CTGATTCTAGGGATGGGGCAGGG - Intergenic
910192396 1:84607241-84607263 CTCATTTCACCCATCGGCCAAGG + Intergenic
911780068 1:101865250-101865272 TTCATTTTAAGGATTGGCCAGGG - Intronic
912304630 1:108554776-108554798 TTCATTTTTGTGATGGGCCAGGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
918132513 1:181642197-181642219 CTCATTTTACAGAAGAACCAAGG - Intronic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
922569256 1:226623943-226623965 GTCATTTGACGTGTGGGCCATGG + Intergenic
923541678 1:234892848-234892870 CACAGTTTAGGGGTGGGCCATGG - Intergenic
1066221402 10:33337869-33337891 CTACTCTTACTGATGGGCCACGG - Intergenic
1069788080 10:71002415-71002437 CTAATTTTAGGCATGGGCCCAGG + Intergenic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1075411459 10:122231604-122231626 CCCATTTTACAGATGGGAGATGG + Intronic
1078421412 11:11216048-11216070 CTCAGAGTAGGGATGGGCCAGGG - Intergenic
1078522218 11:12072677-12072699 CTCAACTTATGGATGGGCAAAGG + Intergenic
1083207326 11:61160702-61160724 CCCACTTTACGGATGGGAGAAGG - Intronic
1087529792 11:99365201-99365223 CTCATTTTAAAGATGGGAAAAGG - Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1090008634 11:123025344-123025366 CTGATTATACGGCTGGGGCAGGG + Intergenic
1091930425 12:4391343-4391365 CTCATTTTCTGTGTGGGCCATGG + Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092746539 12:11677761-11677783 CTCATTTTACGGTTAAGCAATGG - Intronic
1106483248 13:30152447-30152469 TTCATTTTACGGATGAGCAGAGG - Intergenic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1108945718 13:56020057-56020079 CTCATTTTAGGGCAGGTCCAGGG + Intergenic
1109002868 13:56828868-56828890 CTCATTTGACCAATGGACCAAGG + Intergenic
1111995556 13:95162790-95162812 ATCATTATACGGATGGGCAGGGG - Intronic
1118517965 14:66547449-66547471 GTCATATGACGCATGGGCCAAGG + Intronic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1126620490 15:50634544-50634566 CTCTTTTTAGGGATTGGCCAGGG - Exonic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1130935689 15:88468402-88468424 CACGTCTTACGGATGGTCCAGGG + Intronic
1131421073 15:92305842-92305864 CTCATTTTCCGGATGAGGAAGGG - Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1138614864 16:58157292-58157314 CTCATTTGAAGGAGAGGCCAGGG + Intergenic
1140259451 16:73364919-73364941 CTCATTCTACAGGTGGACCATGG - Intergenic
1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG + Intergenic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1142966450 17:3584949-3584971 CTGATTTGATGGATGGCCCAGGG + Intronic
1144830266 17:18127248-18127270 CTCATCTTCCTGGTGGGCCAAGG - Intronic
1145984817 17:29038395-29038417 TTCATTTCAAGGTTGGGCCATGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1149410107 17:56396145-56396167 CACATTTTAAGAAGGGGCCACGG + Intronic
1149413062 17:56428761-56428783 CACATTTTAAGAAGGGGCCATGG - Intronic
1149728381 17:58920549-58920571 CTCATTTTAATAATGGGCCAAGG - Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1151447582 17:74177163-74177185 CTCACTTTGTGGATTGGCCATGG - Intergenic
1152049889 17:77965139-77965161 CCCATTTTACAGATGAGCAAAGG + Intergenic
1152325907 17:79636344-79636366 CCAATTTTACTGCTGGGCCATGG + Intergenic
1155604293 18:27586031-27586053 CTCATTTTATCCATTGGCCAGGG + Intergenic
1159375639 18:67588953-67588975 CTCATTTTAAGAATGGGAGAAGG + Intergenic
1162786745 19:13039873-13039895 ATCATCTCAAGGATGGGCCATGG - Intronic
1165226243 19:34357314-34357336 CCCATTTCTCAGATGGGCCAAGG - Intergenic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166168582 19:41010124-41010146 CTCATGTTGCAGGTGGGCCAGGG + Exonic
1166939295 19:46353132-46353154 CTCATTTTACAGACAAGCCATGG - Intronic
925906772 2:8544499-8544521 CCCATTTTACGGATGTGCAAAGG + Intergenic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
931325634 2:61219304-61219326 CTGATTTTAGGGCTGGGACAGGG - Intronic
935805368 2:106741583-106741605 CTCATTTTGGGGATGGTCTATGG + Intergenic
936434008 2:112487636-112487658 CCCATTTTACAGATGAGACACGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
943599277 2:189894023-189894045 CACATTATACGGATGGGCACTGG + Intronic
944021329 2:195108027-195108049 CTCATTTTCTAGATGGGGCATGG - Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1173104460 20:40120110-40120132 CCCATTTTACAGACGGGTCAGGG + Intergenic
1173888212 20:46480353-46480375 CCCATGTCACTGATGGGCCATGG + Intergenic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
1184928579 22:47662554-47662576 CTCATTAGAAGGATGAGCCAAGG - Intergenic
1185195698 22:49467963-49467985 CTCATTTTCCCGATTGACCATGG - Intronic
950165404 3:10793523-10793545 CCCATTTTACAGATGGGAAATGG + Intergenic
951698241 3:25468152-25468174 TTCATTTTACAGATAGGCTAAGG - Intronic
951867574 3:27324912-27324934 CTCATTACATGGCTGGGCCAAGG + Intronic
951955333 3:28247181-28247203 CTAATTGTATGGATTGGCCAGGG - Intronic
952627606 3:35425837-35425859 CTCATTTTAATGATGGGGAAGGG - Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
955079396 3:55644181-55644203 CTCATTTTACAGATGGTAAAAGG - Intronic
955121191 3:56060352-56060374 CCCATTTTACAGATGGGAAAAGG - Intronic
955231686 3:57105006-57105028 CTGATTTTACAAATAGGCCAAGG - Intronic
957563000 3:81848104-81848126 CTCAGTTTTCTAATGGGCCAAGG - Intergenic
959570501 3:107878033-107878055 AACATCTTACGGATGGCCCAGGG - Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
961737488 3:129011131-129011153 CTCATTTTACAGATGAGCTGAGG - Intronic
963666677 3:148197050-148197072 CCCATTTTACGAATGGGGAAAGG - Intergenic
964366616 3:155957395-155957417 CTGATTTTAGGGCTGGGGCAGGG - Intergenic
965208321 3:165750692-165750714 CTCATTTTGGTGGTGGGCCATGG + Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
973091276 4:46140105-46140127 TGCATTGTACAGATGGGCCAAGG + Intergenic
974366688 4:60959165-60959187 CTCATTTTACTCATGGGAAATGG - Intergenic
977889793 4:102296581-102296603 CTCATTTAACAGATGAGCAAAGG + Intronic
981822744 4:148904333-148904355 CTCCTTTTTCGGATGTACCAAGG - Intergenic
982288582 4:153759056-153759078 CTCGTTTTACGGATGGGATTTGG + Intronic
983412932 4:167421890-167421912 CTTATTGTACGAATGGGCCATGG - Intergenic
984783689 4:183549189-183549211 CTCATTTTAAAGATAGGCAAAGG - Intergenic
985533515 5:448085-448107 CTCCTTTTAAGCATGGGCCACGG - Intronic
987869362 5:23593588-23593610 ATTATTTTACTGATGGGTCAGGG - Intergenic
988337067 5:29920932-29920954 CTTATTGTACAAATGGGCCATGG + Intergenic
992917588 5:81474144-81474166 CTCATCTTTCAGATGGGCTAAGG + Intronic
995100467 5:108295427-108295449 CCCATTTTACTGAAGGGCTAGGG + Intronic
996442412 5:123507008-123507030 CTCATTTTACAGATGAGCTGAGG + Intergenic
999481425 5:151951626-151951648 CTCACTTTACAGGTGGGCCCAGG + Intergenic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1006725871 6:36198323-36198345 CTCATTTTACTGATGGAGTATGG + Intronic
1006990143 6:38208363-38208385 CGCATTGTAGTGATGGGCCAAGG + Intronic
1013381194 6:109572904-109572926 CTCATTTGGTGGATGGGGCAAGG - Intronic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1018393744 6:163361075-163361097 CTCATTCTAGGGCTGGGTCAGGG - Intergenic
1022979982 7:35595316-35595338 CTCATTTTCCGGATGAGGAAAGG - Intergenic
1025823660 7:64994039-64994061 CACCTTTTCAGGATGGGCCAAGG - Intronic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1030412169 7:109194562-109194584 CTCAATTTAAAAATGGGCCAAGG - Intergenic
1032257954 7:130311873-130311895 CTCAGTTTACAGTTGGGCCTTGG + Intronic
1032546679 7:132749552-132749574 ATCAATTTGCAGATGGGCCAAGG - Intergenic
1033553724 7:142470273-142470295 CTCCTTTTGGGGTTGGGCCAGGG + Intergenic
1042290506 8:67166179-67166201 CTGATTCTAGGGATGGGGCAGGG - Intronic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1048200425 8:132369491-132369513 CTGATTTTAGGGCTGGGTCAGGG + Intronic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1053199170 9:36141198-36141220 CTCATTTTATGTATGGGGAAAGG + Intronic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG + Intergenic
1057719691 9:97522015-97522037 ATCATTTCACAGATGAGCCACGG + Intronic
1061363257 9:130157024-130157046 CTCATCTTACAGATGGGAGAAGG - Intergenic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061673053 9:132200028-132200050 CCCATTCTACAGATGGCCCAGGG - Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1062421452 9:136484396-136484418 CTCATTTTTCGGAGGAGCCGAGG + Exonic
1062458424 9:136652031-136652053 CTCACTGTACGGATGGGCCTTGG + Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1187253614 X:17621859-17621881 CTCATTTTACGGATGAGGAAAGG - Intronic
1187672348 X:21680701-21680723 CTCATTCTAGGGATGGAGCAAGG + Intergenic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1198271970 X:135063766-135063788 CTCTTTTTACTCCTGGGCCAGGG - Intergenic