ID: 953420541

View in Genome Browser
Species Human (GRCh38)
Location 3:42750308-42750330
Sequence TCCAGCTGCAACCTTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953420535_953420541 -9 Left 953420535 3:42750294-42750316 CCTCCGTCCCACCTTCCAGCTGC 0: 1
1: 1
2: 3
3: 56
4: 539
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
953420532_953420541 9 Left 953420532 3:42750276-42750298 CCAGCTCAGGGACGCCCTCCTCC 0: 1
1: 0
2: 4
3: 40
4: 357
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
953420531_953420541 18 Left 953420531 3:42750267-42750289 CCAGTAAGGCCAGCTCAGGGACG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
953420528_953420541 24 Left 953420528 3:42750261-42750283 CCTTCTCCAGTAAGGCCAGCTCA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
953420533_953420541 -5 Left 953420533 3:42750290-42750312 CCCTCCTCCGTCCCACCTTCCAG 0: 1
1: 0
2: 11
3: 95
4: 1195
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84
953420534_953420541 -6 Left 953420534 3:42750291-42750313 CCTCCTCCGTCCCACCTTCCAGC 0: 1
1: 0
2: 2
3: 82
4: 791
Right 953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953420541 Original CRISPR TCCAGCTGCAACCTTAATGG AGG Intronic
906481149 1:46199736-46199758 TCCATCTGCTTCCTGAATGGTGG + Intronic
907933420 1:59020644-59020666 GGCTCCTGCAACCTTAATGGTGG - Intergenic
908588095 1:65596459-65596481 TCCATATGCAAACCTAATGGTGG - Exonic
912537946 1:110389750-110389772 TCCAGCTGCATCCATATTGCTGG - Intronic
918393862 1:184094343-184094365 TCCAGGTGGAATCTTAATTGAGG - Intergenic
918909387 1:190546033-190546055 TCCAGCTGTAAAGATAATGGGGG + Intergenic
920014194 1:202892872-202892894 TCCAGTGGCAGCCTTAATGAAGG - Intronic
1066634886 10:37490551-37490573 TTCAGATGCAACCTTATTGCAGG + Intergenic
1067712114 10:48657631-48657653 TCCAGCTGCAACCTTTAGCAGGG + Intergenic
1070945407 10:80387130-80387152 TACAGCTGCAGTCTTAGTGGTGG - Intergenic
1092274313 12:7047836-7047858 GACAGCTGCAACCTCAGTGGGGG + Intronic
1093701795 12:22229881-22229903 TTCATCTGCTACCTTAATGTTGG - Intronic
1105534221 13:21248778-21248800 TCCAGCTGTCACCTTCATTGGGG + Intergenic
1109110940 13:58318483-58318505 TCCAGCTGCAGCCCCAGTGGGGG - Intergenic
1109349096 13:61153901-61153923 TCCATCTGCAACCTTAATTCCGG - Intergenic
1111012191 13:82327211-82327233 TCCAGCTACAACCTTTAGGCTGG + Intergenic
1111037253 13:82692410-82692432 TCCAGATGCTACATTACTGGTGG - Intergenic
1113097751 13:106683976-106683998 TCCAGCTGCAATCTTACAGTAGG - Intergenic
1115374578 14:32660335-32660357 GCCATCTGCTACCTTAATGGTGG - Intronic
1115816423 14:37169029-37169051 TGCAGCTGTAACCTACATGGGGG - Intronic
1116402302 14:44522676-44522698 TCCTGCTGCCACCTTAATTTGGG + Intergenic
1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG + Intronic
1129721903 15:77882165-77882187 TCCAGCTGCAAGCTTAAGACAGG + Intergenic
1134680935 16:16124988-16125010 TCCAGCTCCAACAGGAATGGGGG + Intronic
1138008958 16:53360475-53360497 TGCAGCTGCCACCCTAATGAGGG + Intergenic
1140068881 16:71632302-71632324 TCAAGCTGTAAGCTTAATGTGGG + Intronic
1147168967 17:38607109-38607131 CCCAGTTGCAACCTTAATCTGGG + Intergenic
1147462152 17:40579999-40580021 TCCAACTGCAGCCATATTGGGGG + Intergenic
1158283347 18:55851537-55851559 TAAAGCTGAAGCCTTAATGGAGG + Intergenic
1161280156 19:3441617-3441639 CCCAGCTGTAACCTCATTGGTGG + Intronic
1162479423 19:10920019-10920041 TGCAGCTGCAACCTGGCTGGGGG + Intronic
1166370446 19:42297444-42297466 TGCAGCTGGAAACTTCATGGTGG - Intronic
1166887061 19:45968158-45968180 TCCAGATGCAACATCAATGTTGG + Intronic
926524218 2:13956431-13956453 TCAAGCTTAAACATTAATGGTGG + Intergenic
926854140 2:17233951-17233973 TACAGCTACAACCCTGATGGTGG - Intergenic
929828604 2:45329633-45329655 GCCAGCTGCAATTTTATTGGTGG + Intergenic
934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG + Intergenic
934203919 2:89909772-89909794 TCCATCTGCAGCCATATTGGAGG - Intergenic
936778152 2:115998979-115999001 TCCTGCTGATACCTTAATTGTGG - Intergenic
937674500 2:124575073-124575095 TCCCACTGCAACCTTGATGAGGG + Intronic
940707703 2:157125505-157125527 TACAGCTGCAACTGCAATGGAGG - Intergenic
942191492 2:173474949-173474971 TCCAGCTCCCAACTCAATGGAGG + Intergenic
944350040 2:198715607-198715629 TTCAGCTGGGAGCTTAATGGGGG + Intergenic
947163975 2:227242505-227242527 TCCAGCTGCACCCTTCAGTGAGG - Intronic
948524852 2:238565158-238565180 TCCTGCTGCAACCTTGATCTTGG + Intergenic
948603904 2:239122838-239122860 CCCAGCTGCAACCCCAATGTAGG + Intronic
948736381 2:240009032-240009054 TTCACGTGCAACCTCAATGGTGG + Intronic
1172969086 20:38860533-38860555 TCCACCTCCAACCTGAATGAGGG - Intronic
1177904801 21:26962519-26962541 TCCAGATGCAACTTTCAAGGTGG + Intronic
1184506898 22:44909305-44909327 TTCAGCTGCACCCTTAATATTGG - Intronic
949403147 3:3686304-3686326 TCCAGAAGCAACTCTAATGGAGG + Intergenic
950927595 3:16758283-16758305 TCCAGCAGCAGACTTTATGGTGG - Intergenic
953025645 3:39143419-39143441 GCCAGCTGCTTCCTAAATGGTGG - Exonic
953387222 3:42513503-42513525 TACAGCTGCAGCACTAATGGGGG + Intronic
953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG + Intronic
953458136 3:43060391-43060413 TCCAGGTGCACCCTGATTGGAGG - Intergenic
958489577 3:94754534-94754556 TCCACCTGAAACTCTAATGGAGG + Intergenic
966079531 3:175983228-175983250 TCCAGCTGCATCCGTATTGCTGG + Intergenic
966467670 3:180249720-180249742 ACCAGCTGAAACTGTAATGGAGG + Intergenic
968247645 3:197169356-197169378 TCCAGCTGAAAGGTTATTGGTGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
974691411 4:65302052-65302074 TCCAGCTAAAACCTCAATAGTGG + Intergenic
974892225 4:67896512-67896534 TCCACCTGCAACCCCAATGGGGG - Intergenic
978569151 4:110117555-110117577 TCCAGCTGCATCCTGAAGGCTGG + Intronic
979035346 4:115709345-115709367 TCCTGCTGCTAGCTTTATGGTGG + Intergenic
989617134 5:43348419-43348441 TCCACCAGCTACTTTAATGGTGG - Intergenic
993618937 5:90145787-90145809 GCCATCTGCAACCTGAATGTAGG + Intergenic
1000235571 5:159356466-159356488 TTCAGCTGAAACCTGAATGAAGG - Intergenic
1000712322 5:164596123-164596145 TCATGCTGCAAGCTAAATGGGGG - Intergenic
1000782316 5:165497682-165497704 TCCACCTGCATCCTGAATTGTGG - Intergenic
1021905081 7:25325349-25325371 TACATCTGGTACCTTAATGGAGG - Intergenic
1021997382 7:26193544-26193566 TTCACCTGCAACCTTTATGTGGG - Intronic
1029932172 7:104384016-104384038 TCCACCTGCAACCTGTATGATGG + Intronic
1030272486 7:107685463-107685485 ACGAGCAGCAGCCTTAATGGAGG - Intronic
1035950549 8:4015943-4015965 TCCAACGGCAACCTTCTTGGGGG - Intronic
1037308144 8:17527545-17527567 TCCAGCTGCCACCTTGATTTTGG - Intronic
1046845971 8:118916530-118916552 TCCTGCTTGAACCTTAACGGAGG - Intergenic
1047851790 8:128865273-128865295 GTCAGCTGCAACTTTAATGATGG + Intergenic
1048160406 8:132015357-132015379 TACAGCTGTAACCTTTATGCAGG - Intergenic
1048825613 8:138422962-138422984 TCCAGCTGCATCCATGTTGGCGG - Intronic
1049243020 8:141548344-141548366 TCCAGGGGCATGCTTAATGGTGG + Intergenic
1059158966 9:112015729-112015751 TCAGGGTGCAACCTTAGTGGAGG + Intergenic
1059454980 9:114394783-114394805 TCCAGATGAATCCTTAGTGGGGG + Intergenic
1188423501 X:30017545-30017567 TCCATCTTCAACTCTAATGGTGG + Intergenic
1189114402 X:38327854-38327876 ACCAGCTGGAACATTAAAGGAGG + Intronic
1191100874 X:56726936-56726958 TCCAGTTGCAAGTATAATGGTGG + Intergenic
1194580254 X:95663151-95663173 TCTAGCTAAAAACTTAATGGTGG + Intergenic
1197378246 X:125709181-125709203 TGCAGCTGCACCCATGATGGTGG - Intergenic
1200202986 X:154295380-154295402 TGCAGCTGCAACCGTAAAGGTGG - Intronic