ID: 953421323

View in Genome Browser
Species Human (GRCh38)
Location 3:42755701-42755723
Sequence CTGGATTTAAGTGGTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953421318_953421323 24 Left 953421318 3:42755654-42755676 CCAAAACGTGAGAATGAAAATCA 0: 1
1: 0
2: 2
3: 20
4: 241
Right 953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG 0: 1
1: 0
2: 2
3: 27
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953421323 Original CRISPR CTGGATTTAAGTGGTTTTCA GGG Intronic
901205893 1:7495733-7495755 CCAGATTTAAGTGTTTATCAGGG + Intronic
901373739 1:8822470-8822492 CTGGGTTTAAGTGATTCTCCTGG - Intergenic
901390397 1:8942215-8942237 CTGGGTTCAAGTGATTCTCATGG + Intergenic
903790864 1:25891986-25892008 CTGGCTCTAAGAGCTTTTCAGGG - Intronic
907287307 1:53390123-53390145 CTGGATTTGAGTGGGTTTGGGGG + Intergenic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
909689063 1:78385526-78385548 CTGGAATTAAATAGTTTTGAAGG + Intronic
910347738 1:86259720-86259742 CTGGATTTAAGGGATTTCCTAGG - Intergenic
911925889 1:103832091-103832113 CTGGGTTAAAGTGATTTTCCTGG - Intergenic
911997494 1:104785802-104785824 CTTGATTTAACTGGTTACCAAGG - Intergenic
912362935 1:109109988-109110010 CGAGGTTTAAGTGGTCTTCAAGG - Intronic
912370566 1:109170946-109170968 CTGCATGTAAATGGTTTTTATGG - Intronic
914505744 1:148287745-148287767 CAGGATTTCAGTGGATTCCAAGG - Intergenic
915356968 1:155261247-155261269 AAGAATTTAAGGGGTTTTCATGG - Intronic
918266560 1:182847537-182847559 CTGTACATGAGTGGTTTTCAAGG + Intronic
919493867 1:198239397-198239419 ATGGATTTAGGTGATATTCAAGG + Intronic
921709710 1:218361542-218361564 GGGGATTTAAGTGCTTTTCCTGG - Intronic
922747750 1:228055038-228055060 CTGGATTCAAGTGATTCTCCTGG - Intronic
922821730 1:228489181-228489203 CTGGACTTAAGTGAGCTTCAGGG + Intronic
923454664 1:234153600-234153622 CTGTATTTTAGTTGTTTTCCTGG + Intronic
924307696 1:242708353-242708375 TTGGATTTGAGTGGTTCTAATGG - Intergenic
1063566572 10:7176580-7176602 CTGAATTTGCATGGTTTTCAAGG - Intronic
1063852904 10:10213335-10213357 TTGGGTTTAAGATGTTTTCATGG - Intergenic
1064483764 10:15764881-15764903 CTGGGTTCAAGTGATTCTCATGG - Intergenic
1065181763 10:23133495-23133517 CTTGATTTAAGGTCTTTTCATGG - Intergenic
1067225962 10:44375759-44375781 CTGTATTTATGTGCTTTTTAAGG - Intronic
1067322137 10:45231154-45231176 CTGGAATAAAGTGGTTCACAGGG + Intergenic
1068071722 10:52204823-52204845 CAGGATAACAGTGGTTTTCAGGG + Intronic
1068476508 10:57533348-57533370 CTGGATTTAATTAATTTTGAGGG - Intergenic
1068883972 10:62079551-62079573 CTGGAGTTACATGGATTTCAGGG - Intronic
1068949566 10:62763421-62763443 GTAGATTTCAGTGGTATTCATGG - Intergenic
1069334602 10:67333493-67333515 TTGGATTTAAATGCTCTTCAAGG + Intronic
1069535349 10:69248773-69248795 CTGGCTTTAAGGAGTTTTGACGG - Intronic
1069568313 10:69478437-69478459 GTGGAATGAAGTGGTTCTCAGGG + Intronic
1069908589 10:71746575-71746597 AGGGGTTTAAGTGGTTGTCAGGG + Intronic
1070293967 10:75142928-75142950 CTTGATTTGAGTGTTTATCATGG + Intronic
1070294560 10:75148729-75148751 CTTGATTTGAGTGTTTATCATGG - Intronic
1071241338 10:83708554-83708576 ATGGATTTAAGTGATTTTTCAGG + Intergenic
1073796505 10:106994164-106994186 CTAGATTTAATTAGTTTTAATGG - Intronic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1080579509 11:33630803-33630825 CCCGATTTAAGAGATTTTCAAGG + Intronic
1084216188 11:67648099-67648121 CGGGATTTCAGTCATTTTCAAGG + Intronic
1085558350 11:77446416-77446438 CTGGGTTCAAGTGTTTCTCATGG - Intronic
1085727376 11:78965870-78965892 TTGAATTTAAGTGGTTTCCAAGG + Intronic
1085912601 11:80845882-80845904 GAGAATTTAAGTGTTTTTCATGG - Intergenic
1089655164 11:119941860-119941882 CTGGATTTAGGTTGGATTCAGGG - Intergenic
1091915026 12:4265666-4265688 TAGAATTTAAGTGGTTTTAATGG - Intergenic
1092446035 12:8558380-8558402 CTGGGTTCAAGTGATTCTCATGG - Intergenic
1093892600 12:24541251-24541273 CAGGATATTAGTAGTTTTCAAGG - Intergenic
1094030675 12:26008220-26008242 CTGGAATTCAGTGGCTTTCTCGG - Intronic
1096950665 12:55465587-55465609 CTGGAATTAAAAGGTATTCAGGG + Intergenic
1098123194 12:67264554-67264576 GTGGATCGAAGAGGTTTTCAAGG - Intergenic
1098339667 12:69438859-69438881 CTGGGTTTAACTGCTTCTCAGGG + Intergenic
1098645354 12:72893904-72893926 CTGGATTTAACTGCTTTTTCTGG + Intergenic
1098765363 12:74481726-74481748 CCAGATTTAAATGGATTTCATGG + Intergenic
1098948240 12:76611483-76611505 CTGGATTTTAGAGGTTTGCCTGG + Intergenic
1099617860 12:84961638-84961660 CTGGTTTTTAGTGGTTTTCCTGG + Intergenic
1099775834 12:87128342-87128364 CTGCATTTAAGTGTTTATAAAGG + Intergenic
1101221012 12:102640554-102640576 CTGTATTCAAGTAGTTTTCCTGG - Intergenic
1102344591 12:112151484-112151506 CTGGGTTTAAGTGATTCTCCTGG + Intronic
1103360230 12:120349187-120349209 CTGGATTCAAGTGATTCTCCTGG + Intronic
1105227177 13:18446929-18446951 CTGGATTTATGTGGATATGATGG + Intergenic
1106055195 13:26230787-26230809 CAGTAATTAAGTGGTTTTAATGG + Intergenic
1106253040 13:27997652-27997674 CTGGATTCAAGTGATTCTCATGG - Intergenic
1106634490 13:31512628-31512650 GTTGATTTAAGTGGGTTTCTGGG + Intergenic
1108213803 13:48164266-48164288 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
1109078503 13:57867688-57867710 ATGTATTTAAGTGTGTTTCATGG - Intergenic
1109093592 13:58081527-58081549 AAGGATTTAAGAGCTTTTCAAGG + Intergenic
1110350102 13:74496882-74496904 CTGGATTCAAGTGATTCTCATGG + Intergenic
1113032621 13:106011069-106011091 CTTGATTTGGGTGATTTTCAGGG - Intergenic
1113063151 13:106346146-106346168 GTGGATTTAAGTGGTTTGATTGG - Intergenic
1114011636 14:18375412-18375434 CTGGATTTATGTGGATATGATGG + Intergenic
1114273649 14:21121642-21121664 CTGGATTCAAGCGATTCTCATGG + Intergenic
1114409280 14:22485512-22485534 CTGGGTTTCAGGGGTTTTCCAGG + Intergenic
1114760084 14:25304181-25304203 ATGGTTTTAAGTGATTTTCTTGG - Intergenic
1114901667 14:27068114-27068136 ATGGATTCATGTTGTTTTCAGGG - Intergenic
1115655920 14:35443414-35443436 GGAGATTTAAGAGGTTTTCAAGG + Intergenic
1115840793 14:37468312-37468334 GTGGATTTCAGTGGTTTTCCTGG - Intronic
1116693785 14:48146111-48146133 GAGGAGTTCAGTGGTTTTCATGG - Intergenic
1118511323 14:66477291-66477313 CTGCATTTATATGGTATTCAAGG + Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1119817155 14:77580046-77580068 TTGGAATTATGTGGTTTTTATGG - Intronic
1119913064 14:78368803-78368825 ATGGATTTATGAGGTTTTAAGGG + Intronic
1120740026 14:88097822-88097844 CAGTAATTTAGTGGTTTTCACGG - Intergenic
1121132669 14:91463157-91463179 CTGGATTTAAGCGATTCTCCTGG + Intronic
1121241430 14:92432922-92432944 CTGTGTTTAAGGGGTTTACAAGG + Intronic
1121840574 14:97130482-97130504 CTGGATTTAAGAGGGTTTTTGGG - Intergenic
1122189852 14:100032674-100032696 CTGGGTTTTAGAGGATTTCATGG - Intronic
1122503416 14:102216837-102216859 CTGGGTTCAAGTGATTTTCATGG - Intronic
1122627819 14:103093200-103093222 CTGGATTCAAGTGATTCTCCTGG - Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124199088 15:27661005-27661027 CTGGATTTAAGTGCCTTACCTGG + Intergenic
1126576313 15:50200366-50200388 CTGGAGTGTAGTGGTGTTCAAGG - Intronic
1127667381 15:61161806-61161828 CTGTTTTTAAGTGGCCTTCACGG - Intronic
1128268139 15:66285075-66285097 CTGGATTCAAGTGATTCTCATGG + Intergenic
1128274653 15:66342820-66342842 CTTGAGTTAACTGGTTTACAGGG - Intronic
1129570164 15:76673911-76673933 ATGGATTTAAATGTTTTTAATGG - Intronic
1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1131678846 15:94700720-94700742 ATTGAGTTAAGTTGTTTTCATGG - Intergenic
1131862637 15:96670511-96670533 CTGCATTTTACTGGTTCTCATGG + Intergenic
1132073375 15:98799087-98799109 CAGGATTTAAGATGTTTTGATGG + Intronic
1132178964 15:99737130-99737152 CAGGAATTAAGTGATTGTCAAGG + Intergenic
1132922194 16:2402285-2402307 CTGGATTTCAGTGGTGATCATGG - Intergenic
1134245500 16:12536673-12536695 CTGGTATTAAGAGGTGTTCAGGG + Intronic
1137226256 16:46513515-46513537 CAGGATGTAATTGTTTTTCATGG - Intergenic
1137642151 16:50041747-50041769 TTGTTTTTAAATGGTTTTCAGGG - Intergenic
1139628791 16:68214059-68214081 ATGGTTTTCAGTGGTTTTAAGGG - Intronic
1141407101 16:83804322-83804344 CGGGAGTTAAGGGGTTTTGATGG + Intergenic
1143993891 17:10990277-10990299 CTGGAATGAAGAGGTTTCCAGGG - Intergenic
1146905785 17:36617101-36617123 CTGGCTTTAGGTGGTGTTCCAGG + Intergenic
1147530683 17:41274249-41274271 CTGGATTTAAGGTGTTGCCAAGG - Intergenic
1149833850 17:59894696-59894718 CTGGGTTTAAGCGATTGTCATGG + Intronic
1150657847 17:67051957-67051979 CTGAATTCAAGTGTATTTCATGG - Intronic
1153938723 18:9957123-9957145 CTGGGTTCAAGTGATTCTCATGG + Intronic
1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG + Intronic
1154276593 18:12966628-12966650 CTGGACTCAAGTAGTTTTCTTGG + Intronic
1154526202 18:15292546-15292568 CTGGATTTATGTGGATATGATGG - Intergenic
1156112118 18:33740713-33740735 CTGGGTTTATGGGGATTTCAAGG + Intronic
1160130330 18:76219466-76219488 GAGGATTTAATTTGTTTTCAGGG - Intergenic
1162687275 19:12398404-12398426 CTGAATTTGAGTGATTTTCCTGG - Intronic
1162691593 19:12438236-12438258 CTGAATTTGAGTGATTTTCCTGG - Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1165238136 19:34440228-34440250 CTGGGTTCAAGTGATTCTCATGG - Intronic
1165586539 19:36921365-36921387 CTGGGTTTAAGTGATTCTCCTGG - Intronic
1166650010 19:44566005-44566027 CTGTATTTGAATGGATTTCAAGG + Intergenic
1167929359 19:52851524-52851546 CTGGAGTTCAGTGGTGTTCTCGG - Intronic
1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG + Intronic
925596682 2:5562417-5562439 CTGGATATAATTGTTTTTCATGG - Intergenic
925869523 2:8256926-8256948 CTGGATTCAAGTGATTCTCCTGG - Intergenic
925958573 2:8993893-8993915 CTGACTTTAAGTGCTTTTCCAGG - Intronic
927624002 2:24693400-24693422 CTGGATATAATTAGTTTTAAGGG - Intronic
927663319 2:25011348-25011370 CTGGGTTCAAGTGATTCTCATGG - Intergenic
928315460 2:30241084-30241106 CTGGATTTAAGAGGTATCCTTGG + Intronic
931772924 2:65514613-65514635 TAGGATTTTACTGGTTTTCATGG + Intergenic
931844462 2:66188689-66188711 CTGAATTTGAATGGTTTTGATGG + Intergenic
932283622 2:70515117-70515139 CTGGATTTCAGTGCTTTTCATGG - Intronic
932376580 2:71241311-71241333 CTGGATTCATGTGGTCTTCTGGG + Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
933942996 2:87260636-87260658 TTGGATTTCACTGGGTTTCATGG + Intergenic
935541315 2:104352598-104352620 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
936337217 2:111600926-111600948 TTGGATTTCACTGGGTTTCATGG - Intergenic
936968423 2:118150306-118150328 CTTGATTTAATTTTTTTTCAAGG + Intergenic
938525303 2:132123910-132123932 CTGGATTTATGTGGATATGATGG - Intergenic
939880923 2:147630485-147630507 GGGGTTTTAAGTGCTTTTCATGG - Intergenic
940524982 2:154801675-154801697 CTGGATTTCAGTGGTGATCTGGG + Intronic
941452828 2:165679798-165679820 CTGTATTTAATTGGATTTCCTGG + Exonic
942167875 2:173260272-173260294 CTGGGTTCAAGTGATTCTCAAGG - Intronic
944031512 2:195240272-195240294 CTGGATTTAGGTAGTTCTAAAGG - Intergenic
944696294 2:202203109-202203131 CTGGATTTACGTGGTTCTGAAGG - Intergenic
945249494 2:207752249-207752271 CTGGATGTAAGTGGTAGGCATGG + Intronic
946296617 2:218788899-218788921 CTGGACTTAAGTGTTTTTCAGGG + Intronic
946681669 2:222223396-222223418 CTGAAATTAAGTGCTGTTCATGG - Intronic
947071868 2:226297027-226297049 CTGGGTTCAAGTGATTCTCATGG - Intergenic
1169517205 20:6330646-6330668 ATGTATTTATGTGGTTTTGAAGG + Intergenic
1170059608 20:12245356-12245378 CTGGGTTCAAGTGATTTTCCAGG - Intergenic
1172741088 20:37167929-37167951 CTTCTTTTAATTGGTTTTCAAGG + Intronic
1172934118 20:38607438-38607460 CTGGAGGAAAGTGGTTTGCAAGG - Intronic
1174079625 20:47961776-47961798 CTGGGTTCAAGTGATTCTCATGG + Intergenic
1174817493 20:53699291-53699313 CTGGACTTAAGGGGTTCTCCTGG + Intergenic
1175088281 20:56479726-56479748 CAAGATTAAAGTTGTTTTCATGG - Intronic
1176158124 20:63633349-63633371 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
1176243645 20:64086502-64086524 CAGGATTCACGTGTTTTTCAAGG + Exonic
1176333093 21:5568513-5568535 CTGGATTTAAGTAATTGACAGGG - Intergenic
1176394664 21:6252439-6252461 CTGGATTTAAGTAATTGACAGGG + Intergenic
1176442493 21:6736665-6736687 CTGGATTTAAGTAATTGACAGGG - Intergenic
1176466755 21:7063735-7063757 CTGGATTTAAGTAATTGACAGGG - Intronic
1176490316 21:7445513-7445535 CTGGATTTAAGTAATTGACAGGG - Intergenic
1176510326 21:7692870-7692892 CTGGATTTAAGTAATTGACAGGG + Intergenic
1176660664 21:9632413-9632435 CTGGGTTCAAGTGATTCTCATGG + Intergenic
1176771220 21:13075943-13075965 CTGGATTTATGTGGATATGATGG + Intergenic
1176801909 21:13438373-13438395 CTGGGTTCAAGTGATTCTCATGG - Intergenic
1178174759 21:30083689-30083711 CTGGAGTTAAGTGGTTGCCACGG + Intergenic
1178623878 21:34199645-34199667 AAAGTTTTAAGTGGTTTTCATGG + Intergenic
1180436129 22:15306220-15306242 CTGGATTTATGTGGATATGATGG + Intergenic
1180518369 22:16170388-16170410 CTGGATTTATGTGGATATGATGG + Intergenic
1180956171 22:19742385-19742407 CAGGATTCCAGTGGGTTTCAAGG - Intergenic
1182959526 22:34458913-34458935 CTGGATATAAGTGATTTTGCTGG + Intergenic
1183175312 22:36219912-36219934 TTGGATTTAAGTGCTTTTTTTGG - Intergenic
1183357057 22:37365184-37365206 CTGGATCTCACTGGTTCTCAGGG - Intergenic
1184437308 22:44487104-44487126 CCGGATTCAAGTGGTTCTCCTGG - Intergenic
950453170 3:13077075-13077097 CTGGAGTGCAGTGGCTTTCACGG + Intergenic
951354691 3:21650428-21650450 CTGTATTTAACTGGTTTAGATGG - Intronic
951760427 3:26141431-26141453 TTGGATTTAAGCTGGTTTCATGG + Intergenic
951876416 3:27430736-27430758 CTGGGTTCAAGTGATTCTCATGG - Intronic
952955287 3:38553427-38553449 CTTTAGATAAGTGGTTTTCAGGG + Intronic
953337874 3:42109304-42109326 CTGGATTTTATTGGGTTTGATGG - Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
955107582 3:55913485-55913507 CTGGATTTTTGTGGTTTTTCAGG - Intronic
956387207 3:68732712-68732734 TTGTATTAAAGTGGTTTTAAAGG - Exonic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957321225 3:78633125-78633147 CTGGATTAAAGTTGTTCTTAGGG - Intronic
957619785 3:82580603-82580625 AAGAATTTAAGTAGTTTTCAAGG - Intergenic
958542776 3:95501038-95501060 CTGGATTTCAGTCATTTTAATGG - Intergenic
959284090 3:104384913-104384935 CTTGATAAAAGTGGCTTTCAAGG + Intergenic
962725711 3:138224655-138224677 CTGGGTTCAAGTGATTTTCATGG - Intronic
963437593 3:145290502-145290524 ATGGATTTAAGTGGTTTTTGTGG + Intergenic
965396304 3:168163951-168163973 GTGGATGTAAGTAGTTTTGACGG + Intergenic
966368888 3:179224893-179224915 ATGGCTTTCAGTAGTTTTCATGG - Intronic
967461681 3:189754910-189754932 CTGAATTTTAGCGGTTTTCTGGG - Intronic
968252919 3:197238243-197238265 CTGGTTCTCAGTGATTTTCAAGG - Intronic
969427498 4:7134077-7134099 CTTGATTCAAGTAGTGTTCAGGG + Intergenic
969427529 4:7134345-7134367 CTTGATTCAAGTAGTGTTCAGGG + Intergenic
969438804 4:7205069-7205091 CTGGGGTTAAGTGGTATTGATGG - Intronic
970033568 4:11705560-11705582 CTGCATTTAAGTATTTATCAGGG - Intergenic
970719744 4:18972539-18972561 CTGGATTAAAGGGGGTTTCCTGG - Intergenic
971911884 4:32804681-32804703 CTGGTTATAATTGGTCTTCAGGG - Intergenic
971929611 4:33063355-33063377 CTGGTTTTCACTGGTTTTCCAGG + Intergenic
972798426 4:42446466-42446488 CTGGATTTAAGGGTTGTTTACGG - Intronic
972981370 4:44707089-44707111 ATGGTTTTAAGAGATTTTCAAGG - Intronic
973793599 4:54401050-54401072 CTGCATTCAAGTGGTTACCATGG - Intergenic
974155086 4:58061223-58061245 CTGGATTCAATTGGGTTTTATGG - Intergenic
976677432 4:87718825-87718847 CTTGATTAAGGTGGTTTGCAAGG - Intergenic
977103201 4:92845169-92845191 CTCTATTCCAGTGGTTTTCAGGG - Intronic
978590122 4:110315697-110315719 CTGCCTTTCAGTGGTTTCCAAGG - Intergenic
978616695 4:110604150-110604172 TTGCATTTAAGTTGTTTTCTGGG + Intergenic
978620316 4:110630411-110630433 CTTGATTTAATTGGCTTTTAAGG - Intronic
979841219 4:125443017-125443039 GTGAATTTAAGTGCTATTCATGG + Intronic
980675410 4:136072657-136072679 CTTGTTTTAAGTGGTTGTGAGGG + Intergenic
982758035 4:159247707-159247729 AGGGATTTAGGTGGTATTCAGGG + Intronic
984376232 4:178933988-178934010 CTGTGTTTCTGTGGTTTTCATGG + Intergenic
984978357 4:185252020-185252042 TTGCTTTAAAGTGGTTTTCAGGG + Intronic
987452458 5:18103195-18103217 AGGGATTTAAGTATTTTTCAAGG + Intergenic
990211659 5:53486434-53486456 ATGGACTTAAATGGTTTACAAGG - Exonic
990993530 5:61708281-61708303 CTGGAATTGTGAGGTTTTCAAGG + Intronic
992144596 5:73833169-73833191 GAGGATTTAAGGGATTTTCAAGG + Intronic
992978863 5:82145798-82145820 CTGGATTCAAGTGGTTCTTGTGG + Intronic
994656978 5:102606291-102606313 CTGAATTTATGTGGTTGACATGG + Intergenic
995616781 5:113973333-113973355 CTGGAATAAAGTTGTTTTGAAGG - Intergenic
995714041 5:115064342-115064364 CTGCTTTTTAGAGGTTTTCAGGG + Intergenic
996258546 5:121436985-121437007 CTGGGTTTAAGTGATTCTCCTGG + Intergenic
997339182 5:133129315-133129337 CTGGATTTGAGTGGTTTCTCTGG + Intergenic
997942775 5:138173302-138173324 CTGGATTTAAGTGATTGTCCTGG - Intronic
999624229 5:153503323-153503345 CTGGATATAAAAGCTTTTCAAGG - Intronic
999742309 5:154565628-154565650 CTGGGTTTAAGTGGTTCTCCTGG - Intergenic
1000303388 5:159974819-159974841 CTGGATTTTAGTAATTTTCTAGG + Intergenic
1001145095 5:169176935-169176957 GGGGATTTCAGTGGCTTTCATGG - Intronic
1001602109 5:172935543-172935565 CAGGAATTAAATGGATTTCAGGG - Intronic
1003315173 6:5005007-5005029 ATGGAATTAAGTAGTTTACAAGG + Intergenic
1004472329 6:15940440-15940462 CTGGGTTTAAGTGATTCTCCTGG - Intergenic
1004790105 6:19016179-19016201 CTGGATTTGTGTGGTCTCCATGG + Intergenic
1005812848 6:29529886-29529908 CTGGAATACAGAGGTTTTCACGG + Intergenic
1007577657 6:42936506-42936528 CTGAATTCAATTGATTTTCAAGG + Intronic
1009920143 6:70048109-70048131 CTGGATTTATGTGGGCTCCAAGG - Intronic
1010958430 6:82117957-82117979 CAGAAGTTAAGGGGTTTTCAGGG + Intergenic
1011072084 6:83396268-83396290 CTGGGTTCAAGTGATTCTCATGG - Intronic
1011594625 6:89004541-89004563 CTGGGTTCAAGTGATTCTCATGG - Intergenic
1011594660 6:89004891-89004913 CTGGGTTCAAGTGATTCTCATGG + Intergenic
1012584083 6:100901172-100901194 CAGCATTTCAGTGATTTTCAGGG + Intergenic
1013750414 6:113399530-113399552 TTGGAAGTAAGTGGGTTTCAAGG + Intergenic
1014632031 6:123800487-123800509 CTGTTTTAAAGTAGTTTTCAAGG - Intergenic
1015739740 6:136441304-136441326 TTGCATATAAGTGGTTTTAATGG - Intronic
1016298535 6:142602647-142602669 CTGGTTTTATGTGGTTATCTTGG - Intergenic
1016931286 6:149412890-149412912 CTGAATTCAAGTGATTCTCATGG - Intergenic
1019015180 6:168875140-168875162 ATGAATTTAAAGGGTTTTCAAGG - Intergenic
1020292539 7:6732958-6732980 GTGGATTTAAGAGATTTTCTAGG + Intergenic
1020455624 7:8371120-8371142 ATGTATTTACGTGGTTTTGAGGG + Intergenic
1022201584 7:28122534-28122556 CAGGATTTAAGGGGTTCTCCAGG + Intronic
1023614375 7:42005181-42005203 CTGGTTTTAACTGCTTTTGAAGG + Intronic
1024961883 7:54985254-54985276 CAGGATTTCATTCGTTTTCATGG + Intergenic
1026186706 7:68087496-68087518 CTGGATTTATGGGGACTTCATGG - Intergenic
1027750757 7:82142053-82142075 CAGGTTTTCAGTGGATTTCAAGG + Intronic
1028150816 7:87369117-87369139 TGGGATTTATGTGGTTTTCAGGG + Intronic
1030279778 7:107760460-107760482 GTGGATTTCAGTGCTTTACATGG + Exonic
1031569171 7:123336716-123336738 CTGGATTTCATTGTTTTTTATGG - Intergenic
1031724221 7:125216933-125216955 ATGTATTTAGGTGGTTTTGATGG - Intergenic
1031849432 7:126846189-126846211 CTAGATTTAAGAGTTTGTCAAGG + Intronic
1032294031 7:130618548-130618570 CTAGAATTAACAGGTTTTCAGGG + Intronic
1033323187 7:140358590-140358612 CTCTGTTTAAGTGGTTTCCATGG - Intronic
1037944171 8:22976050-22976072 CTGGGTTTAAGTGATTCTCCTGG - Intronic
1039209793 8:35200711-35200733 CTGGATTCAAGTGATTCTCCAGG - Intergenic
1043704754 8:83334168-83334190 CTGGGTTCAAGTGATTTTTATGG + Intergenic
1044940551 8:97337781-97337803 CTGGATTTCAGTCTTTTTAAAGG - Intergenic
1049096682 8:140552363-140552385 CTGGCTTCAAGTGATTCTCAAGG + Intronic
1049305024 8:141898137-141898159 CTGGATATAAGTTGTTTGTACGG - Intergenic
1052268633 9:26603473-26603495 CATGATTTAAATGGTTGTCATGG + Intergenic
1054747960 9:68874275-68874297 CTAGATTTAATTCTTTTTCATGG + Intronic
1054865311 9:69994307-69994329 CAGGATTAAAGTGATTTTCTAGG + Intergenic
1054992537 9:71345815-71345837 CTGAATATTATTGGTTTTCAGGG + Intronic
1056772420 9:89488795-89488817 TTGGTTTTAAGTTGTTTTAATGG - Intronic
1057909703 9:99008701-99008723 CTGGATTCAAGTGATTCTCATGG + Intronic
1059980613 9:119767654-119767676 CTGGGGATAGGTGGTTTTCATGG - Intergenic
1060484143 9:124036592-124036614 CTGGCATTAGGTGGTCTTCAGGG + Intergenic
1203428604 Un_GL000195v1:66709-66731 CTGGATTTAAGTAATTGACAGGG + Intergenic
1203638233 Un_KI270750v1:134257-134279 CTGGGTTCAAGTGATTCTCATGG + Intergenic
1186408970 X:9329173-9329195 CTGGATTTCAGACGTTTTTAAGG + Intergenic
1187702495 X:21976338-21976360 CTTGGTTAAAGTGGTATTCATGG - Intronic
1188784264 X:34325038-34325060 ATTGATTTAAGAGGTTTTCAAGG - Intergenic
1189072400 X:37877358-37877380 CTGGAGGAAAGTGGTATTCATGG - Intronic
1190459823 X:50661310-50661332 CAGGATTCAAGTGATTCTCATGG + Intronic
1191201495 X:57787348-57787370 CTGGGTTCAAGTGATTCTCATGG + Intergenic
1192676963 X:73207916-73207938 CTGGTTTCAAGTGATTTTCCTGG + Intergenic
1195244402 X:102982587-102982609 CTGGCATTAGGTGTTTTTCATGG + Intergenic
1196694445 X:118595972-118595994 CTGGAATTAAGTGGTGGTCATGG + Intronic
1199538133 X:148926761-148926783 ATGGATTGAAGTGGTGTGCAAGG - Intronic
1199759389 X:150893538-150893560 CTGGATTGGGGTTGTTTTCAAGG - Intronic
1200274650 X:154720356-154720378 ATGGATTTAAGTGTATTTGATGG - Intronic
1202376214 Y:24240024-24240046 CTGGTTTTCCGTGGTTTTCATGG - Intergenic
1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG + Intergenic