ID: 953421557

View in Genome Browser
Species Human (GRCh38)
Location 3:42757249-42757271
Sequence GGCAAAGGCCCTGGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953421547_953421557 13 Left 953421547 3:42757213-42757235 CCCTACAAGGCAAAGGCAGAATT 0: 1
1: 0
2: 3
3: 12
4: 220
Right 953421557 3:42757249-42757271 GGCAAAGGCCCTGGTGGGCAGGG 0: 1
1: 1
2: 1
3: 47
4: 396
953421548_953421557 12 Left 953421548 3:42757214-42757236 CCTACAAGGCAAAGGCAGAATTA 0: 1
1: 0
2: 1
3: 24
4: 289
Right 953421557 3:42757249-42757271 GGCAAAGGCCCTGGTGGGCAGGG 0: 1
1: 1
2: 1
3: 47
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953421557 Original CRISPR GGCAAAGGCCCTGGTGGGCA GGG Intronic
900112440 1:1014157-1014179 GGCCCAGGCCCTGGCTGGCAAGG - Exonic
900290202 1:1920503-1920525 GGCAGTGACCCTGGAGGGCAGGG + Intergenic
900891217 1:5451115-5451137 GGCAAAGGAGCTGCTGGGCCTGG - Intergenic
900913535 1:5618865-5618887 TCCAAAGGCCCTGATGGGGAGGG + Intergenic
901039402 1:6354954-6354976 GGGAAAGGCCCTGGAAGGTATGG - Intronic
901338980 1:8478022-8478044 GCCAAAGGCCCTGGAGAGCCAGG + Intronic
901505081 1:9679673-9679695 GGCAAAGTCACTGGTGCCCAAGG - Intronic
901531821 1:9858488-9858510 TGCAAAGGCCCTGGGGTGTAAGG - Intronic
901660172 1:10794332-10794354 GGAAAAGGCCCTGGTAGTCGCGG - Intronic
901697575 1:11020553-11020575 GGCAAAGGCCCTGAATGGCTTGG - Exonic
902113873 1:14105394-14105416 TGCAAAGGCCCTGGGGTGGAAGG + Intergenic
902586209 1:17439841-17439863 GGCGCAGGCTCGGGTGGGCAGGG - Intergenic
902731693 1:18374031-18374053 GGCTAGAGCCCTGGAGGGCAGGG - Intronic
902903540 1:19537226-19537248 GGCCAAGGCCGGGGTGGGGAGGG - Intergenic
903055467 1:20633430-20633452 GGCGCAGGCGCTGGTGGGCGGGG - Intergenic
903367913 1:22816315-22816337 GCCAAAGGCCCTGGTTGACCAGG + Intronic
903551025 1:24157434-24157456 GGCCAAGGGCCGGGTGGGGATGG - Exonic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904518127 1:31072660-31072682 GGCTTAGGCCCTGGAGGTCAAGG + Intergenic
905124447 1:35707479-35707501 GGCAAAGCCCCTGCTGGAGACGG + Intergenic
905882741 1:41475161-41475183 GGGAAAGGGCTTGGTGGGAATGG - Intergenic
906209205 1:44002822-44002844 GGCACAGACCCTGCTGGGGAGGG + Intronic
906940770 1:50253235-50253257 GGGGAATGGCCTGGTGGGCAGGG - Intergenic
907184704 1:52601008-52601030 TGCAAAGGTCCTGGGGGGAAAGG - Intergenic
907461581 1:54608664-54608686 GCCAGAGGCCCTGGAGGGCAGGG - Intronic
908772253 1:67607781-67607803 AGGAAAGGCCCCAGTGGGCAAGG + Intergenic
909715424 1:78701870-78701892 GGCAGAGGTGCTGGTGGGCAAGG + Intergenic
913217138 1:116630095-116630117 GGCAAGGGTCCTGGAGGGAATGG + Intronic
913516921 1:119612818-119612840 TGCAAAGACCCAGGTGGGAAAGG + Intergenic
914328661 1:146645774-146645796 GGCATTGGCCCTGTTTGGCATGG + Intergenic
914876456 1:151516106-151516128 GACAAAGGGCTTGGTGGGGAAGG - Intronic
915086212 1:153390691-153390713 GGCTATGGCTCTGGTGGGAAGGG + Intronic
915086833 1:153394800-153394822 CGCAAAGGACCAGGTGGGGAGGG + Intergenic
915908819 1:159899760-159899782 GGAAAAAGCACTGGTGGGCCGGG - Intronic
918656144 1:187028272-187028294 GGCTCAGGCCATGGTGAGCAAGG - Intergenic
919621556 1:199869467-199869489 GGCAGAGGTCCAAGTGGGCAGGG - Intergenic
919941413 1:202289031-202289053 GGCAAAGGCTCTCCTGGGGAGGG + Intronic
920183485 1:204146850-204146872 GGCAAGTGCCCTGGTGGGCCTGG - Intronic
920270919 1:204763174-204763196 GGCACAGGCAGTGGTGGGGAGGG + Intergenic
921383368 1:214547182-214547204 GGCAAAGGCACTGCTGGTCTGGG + Intronic
921482031 1:215674695-215674717 GGCACAGGCCCTGGCCAGCAAGG + Exonic
921630114 1:217423164-217423186 TTCAAAGGCCTTGGTGGGCATGG + Intergenic
922176969 1:223204560-223204582 GGCAAGTGCCCATGTGGGCAAGG - Intergenic
922450930 1:225736651-225736673 GGCTACAGCCCTGGTGGGGAGGG + Intergenic
923277476 1:232410673-232410695 GTCAAAGGCCCAGGTGTGGAAGG - Intronic
924315367 1:242789933-242789955 GTCAAAAACCATGGTGGGCAGGG - Intergenic
924488738 1:244513747-244513769 GGCACTGGCAGTGGTGGGCAGGG + Intronic
1065684082 10:28266253-28266275 TGAAAAGGCCCTTGTGGGCTGGG - Intronic
1066442181 10:35449435-35449457 AGCAATGGCCCTACTGGGCAGGG + Intronic
1066789664 10:39048558-39048580 GGGAAAGGCTCTGGTGGAAAGGG + Intergenic
1067057906 10:43062997-43063019 GTCACAGACCCTGGTGGCCACGG - Intergenic
1067211908 10:44266506-44266528 GGAACAGGCCATGGTGGGAAGGG - Intergenic
1069613810 10:69793317-69793339 GACAAAGGTCCTTCTGGGCAAGG + Intergenic
1069790190 10:71014499-71014521 AGCAGAGGCCCTGGTGGAGAAGG - Intergenic
1069913259 10:71772482-71772504 GGCAGAGGCCCTGGTACCCATGG - Intronic
1069994614 10:72334839-72334861 GGCAAAGGAGGGGGTGGGCAGGG + Exonic
1070395755 10:76010102-76010124 GGAAAAGGCCTTGGAGAGCAAGG + Intronic
1070592021 10:77808134-77808156 GGCAGAGGACCTGGTGTCCAGGG - Intronic
1073081296 10:100862642-100862664 GGGTGAGGCCCTGGAGGGCAGGG + Intergenic
1073190700 10:101648871-101648893 GGGAAAAGCTCTGGTGGGGATGG - Intronic
1073269207 10:102247487-102247509 GGCAATGGCCCAAGTGAGCAAGG - Intronic
1073706544 10:105990184-105990206 GGCACAGGCTGTGGTGGGCATGG - Intergenic
1075179368 10:120196240-120196262 GGCACAGGCTGTGGTGGGTAGGG + Intergenic
1076502955 10:130951263-130951285 GGCAATAGCCCTGGTTGCCATGG - Intergenic
1076923451 10:133467484-133467506 TGCAAAGGGACTCGTGGGCAGGG + Intergenic
1077015392 11:396968-396990 GGACACGGGCCTGGTGGGCATGG - Exonic
1077099215 11:814044-814066 GGCAGAGTCCCTGGAGGGGAAGG + Intergenic
1077121567 11:911131-911153 GGCAGAGGCCCTGGAGCCCAAGG - Intronic
1077182434 11:1222785-1222807 GGCAAAGCCGCTGGAAGGCAGGG - Intergenic
1077334762 11:1998318-1998340 CGCAAACCCCCTGGTGGGCGCGG + Intergenic
1077375018 11:2201696-2201718 GGCTAAGCCCCAGGTGGGCCAGG - Intergenic
1077499110 11:2901314-2901336 GGCCAAAGTCCTGGTGGGCAGGG - Intronic
1077580890 11:3416572-3416594 GGCAGAGACCCTGATGGCCAAGG - Intergenic
1077756670 11:5037354-5037376 GGCTGAGGTCCTGGTGGCCATGG + Intergenic
1077868905 11:6245001-6245023 GGCAAAGTCAATGGTGGGCCAGG + Intergenic
1077888216 11:6401679-6401701 GGCAAAGTCCCTGTTGGGGAAGG + Exonic
1079689443 11:23403634-23403656 GGAAAAGGCAATGGTGGCCATGG + Intergenic
1080208991 11:29763292-29763314 TGCAAAGACCCTGATGGGAAAGG - Intergenic
1080214664 11:29827219-29827241 GGAATAGGGCCTGCTGGGCAAGG - Intergenic
1080443179 11:32313833-32313855 AGCAATGGCCCTGGAGGTCAAGG - Intergenic
1080871475 11:36240700-36240722 GGAAAAAGCCCTGGGGTGCATGG - Intergenic
1081630135 11:44683915-44683937 GGCTTGGGCCCTGGGGGGCAGGG + Intergenic
1083619522 11:64042039-64042061 GGCAGCGGCCATGGTGGGCCAGG + Intronic
1083654890 11:64224806-64224828 GGGAATGGCCCTGGTTGGCCCGG + Exonic
1083951697 11:65960067-65960089 GCCAAAGCTCCTGGTGGGGAGGG - Intergenic
1084119308 11:67059726-67059748 GGAGAAGGCCCTGGTCGGGAGGG - Intronic
1084166977 11:67379638-67379660 GGGAAAGCTCCTGGTGGGCGAGG - Intronic
1084377067 11:68784728-68784750 CCCACAGGCCCTGGTGGGGATGG + Intronic
1084493021 11:69488556-69488578 GGAGAAGGCCCTGCTGGGCAGGG + Intergenic
1084515212 11:69634292-69634314 GGCAGAGGCCTGGGGGGGCAAGG + Intergenic
1084937547 11:72595217-72595239 GGCAAAGGGCCTGGGGTGCCAGG - Intronic
1085197873 11:74683318-74683340 AGCTGAGGCCCTAGTGGGCAGGG + Intergenic
1085255299 11:75169306-75169328 GGCACAGACCCTGCTGGGCGTGG + Exonic
1089617332 11:119702247-119702269 GGTGGAGGCCCTGGTGGGAAAGG - Intronic
1089977336 11:122743772-122743794 GGCAGAGGGCCTGAGGGGCAAGG + Intronic
1090893687 11:130950377-130950399 TGCCCAGTCCCTGGTGGGCAGGG - Intergenic
1090945630 11:131427004-131427026 GGCAATGGTTCTGGTGGTCAGGG + Intronic
1091203401 11:133800322-133800344 GGCAAAGTCCCCGGAGGCCAGGG + Intergenic
1091220422 11:133927176-133927198 GGAGAAGGCACTGGTGGGCCTGG + Intronic
1202817745 11_KI270721v1_random:53500-53522 CGCAAACCCCCTGGTGGGCGCGG + Intergenic
1091682186 12:2535012-2535034 GGCAAAGACCCAGGGAGGCAGGG - Intronic
1092108247 12:5939535-5939557 GGGAAAGGCTCTGTTGAGCAAGG + Intronic
1092183634 12:6462942-6462964 GGCTGAGGCCATGCTGGGCAGGG - Intronic
1093781780 12:23145780-23145802 GGTAAAGGCACTGATGGACAAGG + Intergenic
1095406893 12:41876478-41876500 GGAGAGGGCCGTGGTGGGCATGG - Intergenic
1095802351 12:46281889-46281911 GGCATGGGCTGTGGTGGGCAGGG - Intergenic
1097456678 12:59806850-59806872 GGGACAGGGCCTGCTGGGCATGG + Intergenic
1101331124 12:103758684-103758706 GGCAAAGGGCCAGGGGTGCAGGG + Intronic
1102027836 12:109723589-109723611 GGCCAAGTCCCTACTGGGCAGGG + Intronic
1103227730 12:119302663-119302685 AGAAAAGGCCCTCGTGAGCAGGG - Intergenic
1103329626 12:120145025-120145047 TGCAAAGGCCCTTGGGGCCATGG - Exonic
1103357510 12:120332537-120332559 GGCAAAGCACCTGGTGGGGAGGG + Intergenic
1103474027 12:121205160-121205182 GGAAGAGGCCCAAGTGGGCATGG + Intergenic
1103606185 12:122087640-122087662 GGCAAGGGGCCTTGTGGGCCAGG + Intronic
1105699695 13:22926728-22926750 GGCAAAGGTGCGGGTGTGCAGGG + Intergenic
1106790698 13:33152640-33152662 GGCAAAGCCCATGGTGGGTAGGG - Intronic
1107060557 13:36155164-36155186 GGCAGCGGCCCTGGTGGGGTCGG - Intergenic
1108421179 13:50251335-50251357 GGCAAAGGCCTTGTTGGGGTCGG + Intronic
1108682267 13:52790476-52790498 GGCAAAGGCACAGGGGGACACGG - Intergenic
1113122382 13:106937528-106937550 GGCAAAGGCGCTGGGGCGCAAGG - Intergenic
1114559099 14:23578122-23578144 GGGAAAGGCCAGGGTGGGGACGG + Intronic
1118321887 14:64758154-64758176 GGCAAAGCCCCAGGGAGGCAGGG - Intronic
1118603575 14:67487280-67487302 GGAAGGGGCCCTGGTGGCCAGGG - Intronic
1119170782 14:72534869-72534891 GACAAAGGCCCTAGTGGTGAGGG - Intronic
1119201109 14:72753593-72753615 GGCAATGGCTCTCGTTGGCATGG - Intronic
1119383117 14:74240931-74240953 GGCAAAGGCCCCGGCGCGCTTGG - Intronic
1119408301 14:74412206-74412228 GGCAGAGGCCTTGCTGGGCTGGG + Intronic
1119788087 14:77327443-77327465 AGACAAGGCCCTGGTGGGCTGGG - Intronic
1121330595 14:93047131-93047153 GGCAAAGGCAGTGGTGGTAATGG - Intronic
1121679022 14:95777191-95777213 AGCCCAGGCCCTGGTGTGCAGGG + Intergenic
1121738798 14:96237157-96237179 GAAAGAGGCCGTGGTGGGCACGG - Exonic
1122356107 14:101123929-101123951 TGCAGAGGCCCTGGTCAGCAAGG - Intergenic
1122553154 14:102560976-102560998 GACACTGGCCCTGGTGGGCCTGG - Intergenic
1122695494 14:103550208-103550230 GGCACAGGCCCTGGGGGACTCGG + Intergenic
1122866817 14:104609717-104609739 GGCAAGAGCCCTGGGAGGCAGGG - Intergenic
1122896474 14:104760064-104760086 AGCAAAGCTCCTGGAGGGCAGGG - Intronic
1123057741 14:105579950-105579972 GGCAAAGGTCCTGGAGGGCCTGG - Intergenic
1123631476 15:22263062-22263084 GGAGCAGGGCCTGGTGGGCAGGG + Intergenic
1124339579 15:28881439-28881461 GGCACAGGCCTTGTTGGGCCTGG - Intergenic
1124364775 15:29063799-29063821 GGTACAGGCCATGCTGGGCAGGG + Intronic
1124478766 15:30059522-30059544 GGCGGACGCCCCGGTGGGCAGGG + Intergenic
1125593578 15:40870724-40870746 GGGACAGGCCCTGGTGGGGCAGG + Intergenic
1125758697 15:42083099-42083121 GGCCTTGGCCCTGGTGGGCAGGG + Intronic
1126799975 15:52289564-52289586 GGCAAGGGGGCTGGTAGGCAGGG - Intronic
1127617826 15:60704474-60704496 GGCCAGGGCTCTGTTGGGCAAGG + Intronic
1129599205 15:76988423-76988445 GGCCCAGGAACTGGTGGGCATGG - Intergenic
1129851075 15:78794340-78794362 GCCTAAGGCCCTGGTGGGTTAGG - Intronic
1129882298 15:79015458-79015480 GGCAGAGCTCCTGGTGGGCCTGG - Intronic
1130306322 15:82714283-82714305 TGGAAAGGCCCTGGGGAGCAGGG + Intergenic
1131113657 15:89780730-89780752 AGCAAAGGCTCCCGTGGGCATGG + Intergenic
1131121169 15:89824130-89824152 GGCAAAGAGCCTGATGGGCGTGG - Intergenic
1131193587 15:90337086-90337108 GGAAGAGGCCCAGGTGGGGAGGG + Intergenic
1132679624 16:1134395-1134417 GGCAGAAGCCCTGCTGGGCGGGG + Intergenic
1132797502 16:1732493-1732515 CGCAAAGGCCCAGCTGGCCAGGG + Intronic
1132832763 16:1937233-1937255 GCCCCAGGCCCTGGAGGGCACGG - Intergenic
1132839712 16:1973032-1973054 GGCAGAGGCTCTTCTGGGCAAGG + Intronic
1132840079 16:1974632-1974654 GTCGAAGGCCATGGTGGCCACGG - Exonic
1133283192 16:4678611-4678633 GGCAGGGGCTGTGGTGGGCAGGG + Intronic
1134056180 16:11171141-11171163 GGCCGCGGCCCTGATGGGCATGG - Intronic
1135540333 16:23324941-23324963 GGCATGGGGCCTGGTGGGCAGGG + Intronic
1136024639 16:27461729-27461751 GGCAAAGGCCCTGGTGGGAGAGG + Intronic
1137054387 16:35736326-35736348 GGCAGGGGCGCAGGTGGGCAGGG - Intergenic
1137270179 16:46897998-46898020 GGCAAAGGCAGTGGTGGGGTAGG + Intronic
1137483966 16:48876369-48876391 GGCAAAGGTCATGGTGGGAAAGG + Intergenic
1138343810 16:56307858-56307880 GTCGAAGGAGCTGGTGGGCAAGG + Intronic
1139593636 16:67946406-67946428 GGCCTGGGGCCTGGTGGGCAGGG - Intronic
1140004903 16:71065169-71065191 GGCATTGGCCCTGTTTGGCATGG - Intronic
1141767776 16:86070164-86070186 GGCAGAGGCCCCGGTGTCCAAGG - Intergenic
1141893114 16:86941079-86941101 GGCAAAGTCCATGCTGAGCAAGG + Intergenic
1141971533 16:87487409-87487431 GGAGCAGGGCCTGGTGGGCAGGG - Intronic
1142411626 16:89919945-89919967 GGCCAAAGCCCTGGTGGACCGGG - Exonic
1143869068 17:9944941-9944963 GGAAAAGGCCTTGATGGTCAGGG + Intronic
1144946248 17:18971064-18971086 GGCAATGGTCCTGGAGGGAATGG - Exonic
1145018617 17:19414016-19414038 GGGGAAGGCCCTGGTGAGTAGGG - Intronic
1145035486 17:19537596-19537618 GCCAAAGGCCTTGGTGAGGACGG - Intronic
1145321016 17:21767396-21767418 GGCACAGGCCCTGCAGGCCATGG - Intergenic
1146561124 17:33871491-33871513 GGAGAAGGTCCTGGCGGGCAGGG + Intronic
1146760144 17:35469884-35469906 GGGAAAGGTCCAGCTGGGCAGGG - Intronic
1147036885 17:37688202-37688224 GGCCCAGGCACTGGAGGGCAAGG - Intronic
1147388702 17:40096578-40096600 GGAAAAAGCCCTGGAGGGCAGGG + Exonic
1147446495 17:40478183-40478205 GGCACAGGCCCTGGTCCTCAGGG - Intronic
1148028450 17:44604278-44604300 GGCTAAGCACATGGTGGGCATGG - Intergenic
1148458177 17:47821960-47821982 GGCACAGTCCCTGCTGGGCATGG + Intergenic
1148744082 17:49908741-49908763 GGCCTAGGCCCTGGAGGCCAGGG + Intergenic
1148756133 17:49973855-49973877 GCCATAGCCACTGGTGGGCAGGG - Exonic
1149659154 17:58325378-58325400 GGCAACGGCCCAGGTGGGAGAGG - Intronic
1150389169 17:64780897-64780919 GGGAAAGGCCCTGTTGGGGGAGG - Intergenic
1150478531 17:65491879-65491901 GGAAAAGGCCCCAGTGGGGAGGG + Intergenic
1150790275 17:68197016-68197038 GGGAAAGGCCCTGGTGAGGGAGG + Intergenic
1151457061 17:74232589-74232611 GCCCCAGGCCCTGGTGGGGAAGG + Intronic
1151509125 17:74547519-74547541 GACAAAGGCCCGAGTGGGGAGGG - Intergenic
1151566626 17:74902184-74902206 TGCAAAGGCTGTGGTGGGCACGG + Intergenic
1151576638 17:74955758-74955780 GCCTGAGGCCCTGGTGGTCAGGG - Intronic
1151656728 17:75499671-75499693 AGCAGAGGCACTGGGGGGCAAGG - Exonic
1151801481 17:76382339-76382361 GGCAAAGGCCTTGGAGGTGAGGG + Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152301175 17:79495859-79495881 GGCAGAGGCCCCTGTGGGCAGGG + Intronic
1152540582 17:80972392-80972414 AGCAGAGGCCCAGGTGGGCATGG + Intergenic
1152896581 17:82914702-82914724 AGCAAAGGCCATGGAGGGGAAGG - Intronic
1153332073 18:3883702-3883724 GGCAAAGGCCAGGCTGGGCAAGG + Intronic
1153525862 18:5994099-5994121 AGCAGAGGGCCTGGTGGACAGGG - Intronic
1155309566 18:24510408-24510430 TGCAGAGGCCCTGGGAGGCATGG + Intergenic
1155744170 18:29330725-29330747 GACAATGGCTCTGGTGGGCTTGG - Intergenic
1155774106 18:29737438-29737460 GGACAGGGCACTGGTGGGCATGG + Intergenic
1156991945 18:43419661-43419683 GGATAAGGCCCTGTTGAGCATGG + Intergenic
1157070508 18:44402378-44402400 TGCAAAGGCCCTGGTGCAGAAGG + Intergenic
1157820817 18:50767271-50767293 GGCACAGGCTGTGGTGGGCAGGG - Intergenic
1158491819 18:57916766-57916788 GGCAAAGCCCCTGGTCAGAAGGG + Intergenic
1159603632 18:70452489-70452511 AGCAAAGGCCCTGGAGAGCCTGG - Intergenic
1160682226 19:417105-417127 GGCAAAGGAGGGGGTGGGCAGGG + Exonic
1160828890 19:1093616-1093638 GGCAAAGGACATGGGGGGCTGGG + Intronic
1160832534 19:1110494-1110516 GGCGAGGGCCTAGGTGGGCAAGG - Intronic
1161314389 19:3611124-3611146 AGCACAGGGCCTGGAGGGCAGGG - Exonic
1161772519 19:6238795-6238817 GGAGAAGGCCCTGGTGGAGAAGG - Intronic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1163326681 19:16608036-16608058 CACCAGGGCCCTGGTGGGCAAGG + Intronic
1164325567 19:24188311-24188333 GGCAATGACCCTGGTGGGTAGGG + Intergenic
1164862993 19:31577888-31577910 GGCACGGGCCTTGGTGAGCAGGG + Intergenic
1165319603 19:35077024-35077046 GGCAGAGGCCCTGGTGCGGCTGG + Intergenic
1165782204 19:38441290-38441312 GGCAAAGGACCTGGAGCACAAGG + Intronic
1166060790 19:40324100-40324122 GGGAGAGGCCCCGGTGGGCCAGG + Intronic
1166071986 19:40393250-40393272 GGGACAGGCCGTGGTGGGAAGGG - Intergenic
1166344152 19:42155009-42155031 GGCCAAGGCCCTGGTGTGTGTGG - Intronic
1166554293 19:43687929-43687951 GGCAGAGGTCCTGGAGGGCTTGG + Intergenic
1166829472 19:45630106-45630128 GGTGAATGCCTTGGTGGGCATGG - Intronic
1167145948 19:47680930-47680952 GGCCACGGCGCTGGGGGGCAGGG - Exonic
1167311477 19:48740014-48740036 GGCAAACGAGCTGGTGGGCAGGG - Intronic
1167376368 19:49114461-49114483 GGCCGCGGCCCGGGTGGGCAGGG - Intronic
1167656088 19:50765207-50765229 TGCAAAGGCCCTGGGTGGGAGGG + Intergenic
1167658363 19:50780965-50780987 GGCAGAGGGCCTGGTGCGCATGG - Intergenic
1168104044 19:54155855-54155877 GGCAGAGGCCCTGCTGGCCCGGG - Exonic
1168128304 19:54299454-54299476 GGGAAAGTCCATGGAGGGCACGG - Intergenic
1168269979 19:55244513-55244535 AGCACAGGCCAGGGTGGGCAGGG + Intronic
1168326524 19:55541321-55541343 GGCAGAGGCACTGGTGGGGCGGG + Exonic
1168353964 19:55690993-55691015 GGCAAAGGCCCCGGCGGGGATGG - Intronic
925986199 2:9217142-9217164 ACCAAGGGCCTTGGTGGGCACGG - Intronic
928091051 2:28375374-28375396 TCCAAGGGCCCTGGTGGGCTGGG - Intergenic
928171951 2:29009876-29009898 GGCAGGGGCCCTGATCGGCATGG + Intronic
928317957 2:30260372-30260394 GGCAATGGCCCTGGTTCTCATGG + Intronic
928392573 2:30920774-30920796 GCCGTAGGCCCTGGAGGGCAGGG + Intronic
931272822 2:60717744-60717766 GGCACAGGGCATGGTGGGTAAGG - Intergenic
932573631 2:72951065-72951087 AGCCAAAGCCCTGGAGGGCAGGG + Intronic
933647731 2:84826060-84826082 GGCAGAGGGCTTGATGGGCATGG - Intronic
933835351 2:86241207-86241229 GGCAAAGGCCCTGCTGGAAAGGG + Intronic
934521464 2:95022682-95022704 GGCACCTGCCCTGGTGGACAGGG - Intergenic
936432093 2:112473577-112473599 GGGAAAGGCCCTGGAAGGAAGGG - Intergenic
936886680 2:117318867-117318889 AGCAGAGGCCCTGGGGAGCAGGG - Intergenic
938137979 2:128774865-128774887 GGCAGAGGCCCAGGTTGGCCAGG - Intergenic
938318345 2:130345479-130345501 TGCAAAGGTACTGGTGAGCAGGG + Exonic
938323561 2:130381942-130381964 GCCACAGGCCATGCTGGGCAGGG - Intergenic
938761295 2:134428702-134428724 GGCACAGACCCTGATGGTCAGGG - Intronic
939838994 2:147164777-147164799 TGCATAGGCACTGGTGGGCCGGG + Intergenic
943457926 2:188130475-188130497 TGAAGAGGCCCTGGTGGCCATGG - Intergenic
944513753 2:200490369-200490391 AGCCACGGCCCTGGTGGGCACGG - Exonic
944941446 2:204632634-204632656 GCCCAAGGCCCTGGTGGCCAGGG + Intronic
946148972 2:217751359-217751381 GTCAAAAGCCCTGGGAGGCATGG - Intronic
946234947 2:218318360-218318382 GGCCAAAGCCCTGGAGTGCATGG + Intronic
946430138 2:219621739-219621761 GGCAAAGGCCATGAAGGGAAAGG - Intergenic
946782111 2:223202568-223202590 GTCTAAGGCCCTGATGGGAATGG - Intergenic
947633215 2:231666712-231666734 GGCCAAGATCCTGTTGGGCAGGG - Intergenic
947869713 2:233427895-233427917 GCCACCTGCCCTGGTGGGCAGGG + Intronic
948477915 2:238232396-238232418 GGCAAAGGCCCTGAACGGCTTGG - Intergenic
948882894 2:240869367-240869389 GGGAGAGGCCCAGGTGGGGATGG + Intronic
949059507 2:241948954-241948976 TGGAGAAGCCCTGGTGGGCAGGG + Intergenic
1169146297 20:3254730-3254752 GGAAAAGGCCCCAGTGAGCATGG + Intronic
1169505092 20:6201507-6201529 GGCAAAGGCCCTGAATGGCTTGG + Intergenic
1169858675 20:10129847-10129869 GGCAGAGGCATTGGTGGTCAGGG + Intergenic
1170064755 20:12299212-12299234 GGCACTGGCTGTGGTGGGCAGGG + Intergenic
1171127960 20:22620991-22621013 GGCAAGGGCCCAGTTGGGGAGGG + Intergenic
1171154397 20:22859140-22859162 GGCAAAGACAGTGGTGGACATGG + Intergenic
1171226060 20:23442958-23442980 TGGAAAAGCCCTTGTGGGCAGGG - Intronic
1173010363 20:39176454-39176476 GGCAAAGGAGCTGGTGGTCCAGG + Intergenic
1173165673 20:40685422-40685444 GGCAAAGGCCCGGGTCAGCTGGG + Intergenic
1173401966 20:42733909-42733931 GGAAAAGGCCTTGGTGGCAATGG + Intronic
1173409434 20:42796774-42796796 GGCCCAAGCCCTGGTGAGCAAGG + Intronic
1173437239 20:43044215-43044237 GGCAAATCCACAGGTGGGCAGGG + Intronic
1173839890 20:46150508-46150530 GGCAAAGGACCTAGTTGGGATGG - Intergenic
1175217632 20:57399862-57399884 GGCAAGGCCCCTGGAGAGCAGGG + Intronic
1176085853 20:63295122-63295144 GGCAGAGGCCGAGGTGTGCAGGG - Exonic
1176098797 20:63355853-63355875 GGCATAGGCCCCGCTGGGCCAGG + Intronic
1176201713 20:63863892-63863914 GGCTAAGGCCGTGGTGGTAAGGG + Intergenic
1179826436 21:43968683-43968705 GGCAAAGGCCATGATGAGAAAGG - Intronic
1179979866 21:44890285-44890307 GGCAAGGGGCCTGGAGGACAGGG - Intronic
1179997626 21:44981269-44981291 GCCAGAGGTCCGGGTGGGCAAGG - Intergenic
1180265844 22:10526270-10526292 GGCAAAAGCCTTGGCGGCCAGGG - Intergenic
1181435505 22:22908162-22908184 GGAGTAGGCCCTGGTGGGGAGGG - Intergenic
1182151478 22:28030055-28030077 AGCAGAGGCCCTGACGGGCATGG + Intronic
1182445692 22:30387893-30387915 GGGAAAGGGGCTGGGGGGCAAGG + Intronic
1183184436 22:36284062-36284084 GGCAAAGGGGCGGGTGGGCAGGG + Intronic
1183212251 22:36458203-36458225 GGCAGAGGCTCTGCTGGGCCAGG - Intergenic
1183591038 22:38779410-38779432 GGAAAAGGCCCTGCAGGGGACGG + Exonic
1183748452 22:39705612-39705634 GGCATAGGCCATGCTGGCCAGGG + Intergenic
1183961023 22:41412046-41412068 GACAAAGTCCCTGGTGAGGAGGG - Intergenic
1183984437 22:41561824-41561846 GGCACAGCCCCCGGAGGGCAGGG + Intronic
1184110199 22:42389731-42389753 GGCAAAGGGCCTGGGGGGCCTGG - Intronic
1184342658 22:43894459-43894481 GGCAAAGGACCGGGTGGACCAGG - Intergenic
1184538040 22:45100703-45100725 GGCAAAGGCCCTGGGGTGGGGGG - Intergenic
1184744844 22:46450243-46450265 GACAAAGGCCCTGGTGGCTGGGG - Intronic
949142256 3:648881-648903 GGCAAAGTCTTTGGTGGGTAGGG + Intergenic
949942584 3:9166103-9166125 GGCAAAGGCTGTGATGGGAATGG - Intronic
950116872 3:10456677-10456699 GACAAGGAGCCTGGTGGGCATGG - Intronic
950124739 3:10504514-10504536 GGCAAGGGCCCTGGGGGTCTCGG - Intronic
950541975 3:13618285-13618307 GGTAAGGGCCCTGATGGCCAGGG + Exonic
950724153 3:14905683-14905705 GTAAAAGGACCTGGTGGGAAAGG - Intronic
950981824 3:17315376-17315398 GGCAAATGCCCTTTTGGGCCTGG - Intronic
952885361 3:38008476-38008498 CTCAGGGGCCCTGGTGGGCACGG - Exonic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
953421557 3:42757249-42757271 GGCAAAGGCCCTGGTGGGCAGGG + Intronic
953694262 3:45145821-45145843 GGCAAAGACCCTGGGGCGCACGG + Intronic
953916391 3:46923478-46923500 AGCAAAGGGGCTGGTGGGAAGGG + Intronic
954380773 3:50217927-50217949 GGCGAAGGCCATGATGGGGATGG - Exonic
954410608 3:50369099-50369121 CACAAAGGCCCTGGGGGCCAAGG - Intronic
954418366 3:50405348-50405370 AGCAAGGGCCGTGGTGGGGAGGG + Intronic
954881091 3:53836410-53836432 TGCAAAGGCCCTGGGGAGGAAGG - Intronic
955054452 3:55443498-55443520 TGCACAGGCTCTGGTGGGAAAGG - Intergenic
955367644 3:58325380-58325402 GGCTAAGGCCTAGCTGGGCATGG - Intergenic
956796837 3:72725383-72725405 TGCAAAGGCCCTGGGCTGCATGG - Intergenic
957053760 3:75429168-75429190 GGCAGAGACCCTGATGGCCAAGG - Intergenic
960620723 3:119634155-119634177 GACAAAGTCCCTGTTGGTCAAGG - Intergenic
961887439 3:130105562-130105584 GGCAGAGACCCTGATGGCCAAGG - Intronic
962318986 3:134375580-134375602 GGGAAAGCCCCTGGCTGGCAGGG - Intergenic
962918392 3:139929318-139929340 GGCAAAGGTGCTGGTGGGGCTGG + Intergenic
964380934 3:156098591-156098613 GGCAAAAGCCCTGGTGGCCCAGG - Intronic
965520519 3:169664847-169664869 GGCAAAGGCTGTGGAGGGAAAGG + Intergenic
966595818 3:181724035-181724057 GGTAGATGCCGTGGTGGGCAAGG - Intergenic
968515511 4:1013923-1013945 GGCAAAGGCCCTGGCGGCACTGG + Intronic
968652451 4:1765655-1765677 GGCAAAGCCCATGGCGGGCCTGG + Intergenic
968850115 4:3073381-3073403 GACACAGGCCGTGGCGGGCAGGG - Intergenic
969639704 4:8389431-8389453 GGCAAAGGCTGGGGTGGGGAGGG - Intronic
969817395 4:9696738-9696760 GGCAGAGACCCTGATGGCCAAGG + Intergenic
972880023 4:43410879-43410901 GCCAGAGGCCCTGGTGGCCCTGG - Intergenic
973266481 4:48216124-48216146 TGCAAAGGCCCTGGGGTGAAAGG - Intronic
975769493 4:77705970-77705992 GGTAAAGGACCTGGTTGGGAAGG + Intergenic
976361956 4:84190186-84190208 TGCAAAGGCCAAGATGGGCAAGG + Intergenic
976378997 4:84378463-84378485 GCCATAGGCTCTGCTGGGCAAGG - Intergenic
977120174 4:93090241-93090263 GTCCAGGACCCTGGTGGGCATGG - Intronic
977430350 4:96924721-96924743 GGCATAGGCACAGGTAGGCATGG + Intergenic
977586925 4:98784335-98784357 TGCAGAGGGCCGGGTGGGCAAGG + Intergenic
979765911 4:124463637-124463659 GGCGGAGGGACTGGTGGGCAGGG + Intergenic
979829439 4:125281391-125281413 GCCAGAGGCCCTGGCGGGCATGG + Intergenic
983536965 4:168868148-168868170 GGGAAAGGCCCTGCTTGGCCTGG + Intronic
983944428 4:173569510-173569532 TGCCAGGGCACTGGTGGGCAAGG + Intergenic
985493477 5:192272-192294 ATCAAAGGCCTTGGTGGGCAGGG - Exonic
985726127 5:1516541-1516563 GGCCAAGGTACTGGAGGGCAAGG - Intronic
985969779 5:3365878-3365900 GGCCATGGCCCTTCTGGGCATGG - Intergenic
986291833 5:6406390-6406412 GGCAGAAGCACTGGTGAGCAGGG + Intergenic
986876306 5:12115338-12115360 GGCAAAGGGCCTGGGGTACAGGG - Intergenic
988465080 5:31482357-31482379 AGCACAGGACCTGGTGGGGAAGG + Intronic
988809523 5:34770658-34770680 GGCAAAGGCCCTGAGGTGGAAGG + Intronic
989167178 5:38443698-38443720 AGCAAAGGGCCCTGTGGGCATGG - Intronic
990545475 5:56816445-56816467 GGCAAAGGCACTGGGGGGCGAGG + Intronic
992066401 5:73113852-73113874 GGCAATGCCCCTGGCTGGCAAGG + Intergenic
993111535 5:83663044-83663066 CACAAATGCCCAGGTGGGCAAGG + Intronic
994784886 5:104145458-104145480 GGCTTGGGCCCTGGAGGGCAAGG - Intergenic
995271744 5:110227830-110227852 GGCACCGCCCATGGTGGGCAGGG - Intergenic
995531008 5:113091814-113091836 GGTCAAGGCCATGGTGGGCTAGG + Intronic
997364062 5:133314263-133314285 GGCTAAGACCCTGAGGGGCAGGG - Intronic
997571382 5:134930404-134930426 GGAAAAGTCCCTGGTGAGAAAGG - Intronic
997835868 5:137193113-137193135 GGCAAAGACTCTGGAGGGGAAGG + Intronic
998381832 5:141731174-141731196 GGCTCAGGCCCAGTTGGGCAGGG + Intergenic
999250493 5:150179654-150179676 GGCGAAGGTCTGGGTGGGCAGGG + Intronic
999769701 5:154766107-154766129 AGGAAAGGCCCTGGTGTTCAGGG + Intronic
1001288657 5:170441167-170441189 GGCAGAGGCCCTGCTGGGCTGGG - Intronic
1001917685 5:175575417-175575439 GGCAGAGGCCCTGGGGGTCTGGG - Intergenic
1002077010 5:176714303-176714325 TGCAAAGGCCCTGGGGGGGTGGG - Intergenic
1002185496 5:177452916-177452938 TGCCAGGGCCCTGGTGGGAAGGG + Intronic
1002469791 5:179428548-179428570 GGACAGGGCCCTGGTGGGCCAGG - Intergenic
1002535705 5:179874300-179874322 GGGAAAGGGCATGGTGGGCCTGG + Intronic
1003263500 6:4546508-4546530 GGCAAAGGCCCTGCCTGCCATGG - Intergenic
1005423664 6:25678808-25678830 GGCCAAGGACCTAGTGAGCAAGG - Intronic
1005873445 6:29994487-29994509 GGCCCAGGCCCTGGTGCTCAAGG - Intergenic
1006510815 6:34520147-34520169 GGCAGAGGCTCTAGTGGACACGG + Intronic
1007634187 6:43288006-43288028 GGGACCAGCCCTGGTGGGCATGG + Exonic
1007994023 6:46287187-46287209 GTCAAAGGCCTTGGTGTGCTAGG - Intronic
1008497993 6:52152345-52152367 TGCAAAGACCCTTGAGGGCAAGG - Intergenic
1010387610 6:75300363-75300385 GGCAGAGCCCCTGGTGGGTAGGG - Intronic
1013303374 6:108824898-108824920 AGCAAAGGCCATGCTGGGCATGG + Intergenic
1016116397 6:140290838-140290860 GGCACAGGCTATGGTGGGTAGGG - Intergenic
1016739671 6:147513881-147513903 GGCAAAGGTCCTCGACGGCATGG - Intronic
1018047046 6:159974756-159974778 ATCAAAGGCCCTGGAGGGGAGGG + Intronic
1018229200 6:161659663-161659685 GGCAACGGCCCTGGAGGACATGG + Intronic
1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG + Intergenic
1019427099 7:983006-983028 GGCTGAGGCCCTGGTGGGGCCGG - Intergenic
1019453059 7:1109683-1109705 GGGAAGGGCCCTGCTGGCCATGG - Intronic
1020016523 7:4834913-4834935 CGCCAAGGCCCGGGCGGGCAGGG + Exonic
1021729764 7:23585045-23585067 GGCCCAGGGCCTGGTGGTCACGG + Intergenic
1024094449 7:45972952-45972974 GGCACAAGCCCCTGTGGGCAGGG + Intergenic
1025263891 7:57440094-57440116 GTCAGAGTCCCTCGTGGGCAGGG + Intergenic
1025635343 7:63316015-63316037 GTCAGAGTCCCTCGTGGGCAGGG - Intergenic
1025647351 7:63432155-63432177 GTCAGAGTCCCTCGTGGGCAGGG + Intergenic
1026635202 7:72075935-72075957 GGCATAGGCACTCATGGGCATGG + Intronic
1026737765 7:72959971-72959993 GGGGAAGGCCCTGGCGGGTATGG + Intronic
1026788799 7:73318772-73318794 GGGGAAGGCCCTGGCGGGTATGG + Intronic
1027105969 7:75405097-75405119 GGGGAAGGCCCTGGCGGGTATGG - Intronic
1029217948 7:98965374-98965396 GGCAGGGGCTGTGGTGGGCATGG + Intronic
1029536489 7:101160560-101160582 GGCATAGCCCCTGCTGGGCCGGG + Exonic
1029688709 7:102166157-102166179 GGCAAGGGGACTGGTGGCCACGG - Intronic
1031294404 7:119983634-119983656 GAGAGAGGTCCTGGTGGGCATGG - Intergenic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1032274275 7:130440865-130440887 GGAAAAGGCTCATGTGGGCAGGG - Intronic
1033132370 7:138755595-138755617 AGCAAGGGCCCTGGGGGGCAGGG + Intronic
1034490117 7:151388654-151388676 GGCAGAGGCCCCTCTGGGCACGG + Intronic
1038195235 8:25361024-25361046 GGCAAAGGCCTAGCTGTGCACGG - Intronic
1038492571 8:27981381-27981403 GGGAAAAGCCCAGGTGGACAGGG + Intronic
1039892190 8:41693267-41693289 TGCTAAGGCCGTGGTGTGCAAGG + Intronic
1041465637 8:58155306-58155328 GGCAAGGGGCCTGGTCGGGAGGG - Intronic
1041915784 8:63137434-63137456 GGCAAAGGCCCTGAACGGCTTGG + Intergenic
1042570392 8:70157137-70157159 TGCACAGGGCCTGATGGGCAGGG + Exonic
1047104797 8:121720397-121720419 GGCTCAGGCCCAGGTGGGCAGGG + Intergenic
1047702270 8:127461146-127461168 GGCCAAGGCCATGGTGGGAGGGG - Intergenic
1048579950 8:135722599-135722621 GGCAAAGGCCCTGGAGGGCAGGG + Intergenic
1049383029 8:142326705-142326727 AGTAAAGGCCCTGGAGAGCATGG + Intronic
1049488721 8:142879780-142879802 GGCAAAGGCAGAGGTGTGCATGG - Exonic
1049761297 8:144333022-144333044 GGCAAGGCCCCTGGCGGGCGGGG + Exonic
1050416891 9:5427805-5427827 GACAAGGGCCCTGGTTGGCTGGG + Intronic
1053000235 9:34573936-34573958 GGACAAGGACATGGTGGGCAGGG + Intronic
1056257862 9:84818778-84818800 TGGAAAGGGCCTGGTGGGAAGGG + Intronic
1056494991 9:87147903-87147925 GGCAATGGACCTGGTGTGCCTGG - Intergenic
1057282321 9:93721768-93721790 TGCAAAGGCCCTGGGGGAAAAGG - Intergenic
1058164776 9:101607006-101607028 GGCAGAGGCACAGGTGTGCAGGG + Intronic
1058797362 9:108511639-108511661 GGCAAAGGACATGGTAGGCAGGG - Intergenic
1060268196 9:122124481-122124503 GGAATTGGCCATGGTGGGCATGG - Intergenic
1060744174 9:126119253-126119275 TGCAGAGGCCCGGCTGGGCATGG - Intergenic
1060923413 9:127438492-127438514 ATCAAAGGCCCAGGAGGGCAGGG - Intronic
1060970399 9:127734499-127734521 GGCCAAGGCGCTGGTGGTGAAGG - Exonic
1061075690 9:128340345-128340367 GGCAAGGGCCGGGGTCGGCAGGG + Intergenic
1061145117 9:128793105-128793127 AGCAAAGGCCATGTTGGGCAGGG + Intronic
1062476202 9:136728620-136728642 GGCAGAGCCCCTGGTGGGGAAGG - Intergenic
1185734913 X:2489198-2489220 GGCCAAGGGCCTGCTGGACAAGG - Exonic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1187225594 X:17373356-17373378 GGCAAAGGCCCAGGAGAGAAAGG - Intergenic
1187326484 X:18295234-18295256 GGCACTGGCTGTGGTGGGCAGGG - Intronic
1187856096 X:23637276-23637298 GGCACAGGCTGTGGTGGGCAGGG - Intergenic
1189227664 X:39426971-39426993 GGGAAAGGCCCTGTGGGGAAGGG + Intergenic
1189821618 X:44873966-44873988 GACGAAGGCCCTACTGGGCAAGG + Exonic
1190115860 X:47626080-47626102 TGCAGAGGCGCTGGCGGGCACGG + Exonic
1190735052 X:53250588-53250610 GGCAGGGGCCCTGGTGGGGCTGG + Exonic
1195793855 X:108621835-108621857 CCCAAAGGTCCTGGTGGGCCTGG - Exonic
1195981343 X:110581607-110581629 GGCATAAGCCCTGGTTGCCAGGG - Intergenic
1198618392 X:138481852-138481874 GTCCCAGGCCCTGCTGGGCATGG + Intergenic
1198651106 X:138864612-138864634 GCCAAAGGCCCATGTGGCCAGGG + Intronic
1198715667 X:139555514-139555536 GCCAAAGGCACTGGCGGGCCGGG + Intronic
1200060629 X:153482253-153482275 GGCACAGGCCTTCCTGGGCATGG - Intronic
1200076454 X:153553686-153553708 AGCAAAGGTCCTGGCGGGAAAGG + Intronic
1200818501 Y:7557769-7557791 AACTAAGTCCCTGGTGGGCAAGG + Intergenic
1201578265 Y:15483748-15483770 TGTAAAGGCACTGGTGGGCTTGG + Intergenic