ID: 953422642

View in Genome Browser
Species Human (GRCh38)
Location 3:42766251-42766273
Sequence GGGTGGGTCTGGGGTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953422642 Original CRISPR GGGTGGGTCTGGGGTTCAGA AGG Intronic
900120496 1:1046722-1046744 GGGTGGCTCTGGGGGTGAGCAGG + Exonic
900690783 1:3978994-3979016 GGGTGGGTAATGGGGTCAGAAGG + Intergenic
900764486 1:4494767-4494789 GCGTGGGTCGGGCATTCAGAGGG - Intergenic
901376856 1:8845807-8845829 GCGTGGGTTTGGGGTCCAGTTGG - Intergenic
901813766 1:11782336-11782358 GGGTGGGCCTGGGGGTGGGAGGG + Intronic
901930593 1:12594529-12594551 GGGTGGGAGTGGTATTCAGATGG + Intronic
901935451 1:12623128-12623150 GGGTGGGGCTGGGGCTGAGGGGG + Intergenic
902115319 1:14116397-14116419 GCTTGGGTCTTGGCTTCAGAGGG + Intergenic
903831435 1:26177602-26177624 GGGTGGGGCTGGGGTAGAGTTGG + Intronic
903890087 1:26563809-26563831 GGATGGGAATGAGGTTCAGATGG + Intronic
904688851 1:32278963-32278985 GAGGGGGTCTGGGGGTCTGAGGG - Intronic
904964360 1:34360334-34360356 GGGAGGGTCTGGGGTTGGGGAGG + Intergenic
905303130 1:36999079-36999101 GGGTGGCTCAGGGGAACAGATGG + Intronic
905403775 1:37720118-37720140 GGCTGGATCTGGGGCTCAGTGGG - Intronic
905796914 1:40820995-40821017 GCTTGGGTTTGGGGCTCAGAGGG - Intronic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906186692 1:43867491-43867513 ATGTGGGTCTGGGGTTCCCAGGG + Intronic
906913541 1:49982715-49982737 GGGTTTTTATGGGGTTCAGAGGG - Intronic
906944176 1:50281581-50281603 GGGTGGGTCTCAGGCTAAGAGGG - Intergenic
907631228 1:56084214-56084236 GGCTGTGTCTGGAGTTCAGGGGG + Intergenic
907790498 1:57658985-57659007 GGATGGGACTGGGGTTCCCAGGG - Intronic
908938924 1:69409405-69409427 GGGTTTGTATGGGCTTCAGAGGG - Intergenic
912261168 1:108112649-108112671 GGGTTGGTCCTGGGCTCAGAAGG - Intergenic
912459955 1:109823954-109823976 GGGTGACCCTGGGGGTCAGAGGG - Intergenic
912736185 1:112151500-112151522 GTATGGGTCTTGAGTTCAGAAGG + Intergenic
913241679 1:116835327-116835349 GTGTGTGTCTGGGGTGCGGAGGG + Intergenic
914764049 1:150622564-150622586 GGGTGGGGGTGGGGTTGAAAGGG - Intronic
915234767 1:154472581-154472603 GGGTGGGCCTGTGCATCAGAAGG + Intronic
916127756 1:161586659-161586681 GGGAGGGTTTGGGGTTCATAAGG - Intronic
916137675 1:161668463-161668485 GGGAGGGTTTGGGGTTCATAAGG - Intronic
916218461 1:162419569-162419591 GGGTGGGAGTGGGTTTCAGGAGG - Intergenic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
917661345 1:177180286-177180308 GGGTGGCTCTGAGGTTCAATGGG + Intronic
918118310 1:181515931-181515953 GGCTGGGGCTGGGGTAAAGAGGG + Intronic
918703351 1:187632313-187632335 AGGTGGGTCTGGCATGCAGATGG + Intergenic
919765432 1:201124360-201124382 CGATGGGTGTGTGGTTCAGAGGG - Intronic
919856956 1:201712601-201712623 GCCAGGATCTGGGGTTCAGAGGG + Intronic
920068991 1:203289216-203289238 GGGTGGGCTTTGGGGTCAGATGG - Intergenic
920366229 1:205449753-205449775 GCCTGGGTCTGGGGTTCTGGGGG - Intronic
921137484 1:212274528-212274550 TGGTGGGTATGGGGTTTGGAGGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922475465 1:225904441-225904463 GCATGGGCCTGGGGCTCAGAGGG - Intronic
922504914 1:226120874-226120896 GGATGGGCCTGTGGTTCAGCTGG - Intergenic
1063615624 10:7597504-7597526 GGGTGTCTATGGGGTACAGAGGG - Intronic
1063615638 10:7597563-7597585 GGGTGTCTCTGGGGTACAGAGGG - Intronic
1063615652 10:7597622-7597644 GGGTGTCTCTGGGGTACAGAGGG - Intronic
1064029969 10:11877454-11877476 GGGTGAGTCTGGGCCTGAGAAGG + Intergenic
1064782416 10:18856998-18857020 AGGTGGGAGTGGGTTTCAGAAGG + Intergenic
1065773244 10:29096868-29096890 GGATGGGGATGGGGATCAGATGG - Intergenic
1065998842 10:31085323-31085345 GGGTGGTTCAGGGGTGCAGTGGG + Intergenic
1066349390 10:34623641-34623663 GGGTGGAGCTGGGGTTTAGGGGG - Intronic
1067123096 10:43491505-43491527 GAGTGGTTCTGGAGCTCAGAAGG - Intergenic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1068351250 10:55848499-55848521 GGGTGGGTCTGAGGTTCTCCAGG - Intergenic
1069680042 10:70277753-70277775 GGGTGGGGCTGGGGTTAGGCTGG + Intronic
1069691894 10:70359186-70359208 GGGCGGGGCTGGGGTTTGGAGGG - Intronic
1069908055 10:71743636-71743658 GGGTGGGGCTGGGGCAGAGAGGG + Intronic
1070923110 10:80201441-80201463 TGGTGGGTCTGGGGCTCAGGAGG - Intronic
1073504737 10:103975189-103975211 GTGTGGATCTGGAGTTCAAAAGG - Intronic
1075087963 10:119426190-119426212 GGCTGTGAGTGGGGTTCAGAAGG - Intronic
1076238822 10:128887069-128887091 GTGTGGGTCTGGGATACAGTAGG - Intergenic
1076653565 10:132006306-132006328 GGGTGGGTGTGGGGGTGGGAGGG + Intergenic
1076676402 10:132149650-132149672 GGGTGGGGCGGGGGTGGAGAGGG - Intronic
1076774547 10:132687521-132687543 AGGTGGGTCTAGGGTGCAGCAGG - Intronic
1076839430 10:133038818-133038840 GAGTGCTTCTGGGGTTAAGATGG - Intergenic
1076930796 10:133530461-133530483 GGGTGGGGCAGGGGTGCAGCTGG - Intronic
1077032409 11:474432-474454 GGGTGGGTGAGGGCTCCAGATGG + Intronic
1077032423 11:474473-474495 GGGTGGGTGAGGGCTCCAGATGG + Intronic
1077201131 11:1308211-1308233 GGGTGGGTGTGTGGGTCACAGGG + Intronic
1077303421 11:1857303-1857325 AGGAGGGTCTGGGGTCCAGCTGG + Intronic
1077440335 11:2565939-2565961 GGGAGGGTGTGGGTGTCAGATGG - Intronic
1077460194 11:2705257-2705279 TGGGGGGTCTGGAGTTCAGGCGG + Intronic
1077502597 11:2916143-2916165 GGGTGGGCCTGGCATTCAGCAGG - Intronic
1077528916 11:3086203-3086225 GCGTGGGCCTGGGGTGCAGGAGG + Intergenic
1077533481 11:3108053-3108075 GGGTGGGTCTGGGATGGAGGGGG - Intronic
1077545397 11:3167033-3167055 GGGTGGGGCTGGGGTGGAGCAGG + Intergenic
1077638108 11:3856883-3856905 GGGTGGGACTAGGGTTCCCACGG - Intronic
1077684163 11:4275217-4275239 GGGCGGGTGGGGGGTGCAGAGGG + Intergenic
1078006779 11:7538151-7538173 GTGTGAGTCTGAGGTTCTGATGG - Intronic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1078652638 11:13209957-13209979 GGGATGGGCTGGGGTTCAGAAGG - Intergenic
1081478268 11:43458370-43458392 TGATGGGTCAGGGCTTCAGAAGG + Intronic
1082011504 11:47452832-47452854 GGGACGCTCTGGGGGTCAGAAGG + Intergenic
1083284741 11:61651191-61651213 GGGAGGCTCTGGGGCTCTGAAGG - Intergenic
1083371466 11:62185589-62185611 GGGTGGGAGTGGGTTTCAGGGGG + Intergenic
1083614177 11:64018288-64018310 GGGGGGCTCTGGGGGTCAGGTGG + Intronic
1083630890 11:64094797-64094819 GGCTGTGCCTGGGGTTCACAGGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083898738 11:65633488-65633510 GGGAAGGTCCGGGGTTCAGGCGG + Intronic
1083961503 11:66017231-66017253 GGGTGGTTCTGGGGTGCAGTAGG - Intronic
1084463529 11:69309157-69309179 GGGTGAGTGGGGGGTTCTGATGG + Intronic
1084950863 11:72664770-72664792 GGGGGGATCTGGGGTCCAGATGG - Intronic
1085256464 11:75176291-75176313 GACTGGGTCAGGGGCTCAGAGGG + Intronic
1085496898 11:76978349-76978371 GGCTGGGTCTGGGGTTTTTATGG - Intronic
1085700109 11:78738338-78738360 GGATGGGTCTTGGATTCAGAGGG - Intronic
1086929042 11:92672217-92672239 GAGTAGGTCTGGGGATGAGAAGG - Intronic
1088588201 11:111378804-111378826 GGATGGGTTTGGGGTTGGGAGGG - Intronic
1088627395 11:111739505-111739527 GCATGGGTCGGGGGTTCAGCGGG - Intronic
1088651146 11:111958812-111958834 GGTTGAGTCTGGGGTTTTGATGG - Intronic
1088906734 11:114160836-114160858 AGGTGGTTTTGGGGGTCAGAAGG + Intronic
1088952993 11:114589357-114589379 GGCTGGCTCTGGTGTCCAGAAGG - Intronic
1089382771 11:118047959-118047981 AGGTGTCTCTGGGGCTCAGATGG + Intergenic
1090074155 11:123568964-123568986 GGATGGGACTGGGGTTCAAAAGG - Intronic
1090419471 11:126564288-126564310 GGGTGGACCTGGGCTGCAGACGG - Intronic
1090808657 11:130218628-130218650 GGATGGATGTGTGGTTCAGAAGG + Intergenic
1091283029 11:134392723-134392745 GGGGGTGTCTGGGACTCAGATGG + Intronic
1091307039 11:134542932-134542954 GAGTGGGCCTGTGGGTCAGAGGG + Intergenic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1091827433 12:3523440-3523462 GGGTGGGCTTGGGGTGGAGATGG - Intronic
1091844988 12:3648893-3648915 AGCTGGGTCTGGGGTTAGGAGGG - Intronic
1091963662 12:4720337-4720359 GGGTGGGAGTGGGTTTCAGGAGG + Exonic
1091998582 12:5015186-5015208 GGGTGGGTCATTGTTTCAGAGGG + Intergenic
1092060805 12:5548887-5548909 GTGTGGGTCTGGGGTTGGAAGGG - Intronic
1092463469 12:8706868-8706890 TAGTGGGTCAGTGGTTCAGAAGG + Intronic
1094731819 12:33185389-33185411 GGCTGGGTCAGGACTTCAGATGG + Intergenic
1096253874 12:50051210-50051232 GGCTGGGTCTGGGCTTCCCAGGG - Intergenic
1096656602 12:53096490-53096512 GGGTGGGTGTGGGTTGCCGAAGG + Intergenic
1099295437 12:80822989-80823011 GGGTTTGTATGGGCTTCAGAGGG - Intronic
1100444850 12:94650675-94650697 GGGTGGGTGGGGGGTCCAGGCGG - Intergenic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1103156327 12:118688204-118688226 GGGTGGGGGTGGGCTTCTGAGGG + Intergenic
1103238694 12:119396350-119396372 GGGTGGATGTGAGTTTCAGAAGG + Intronic
1103886591 12:124207033-124207055 GGGTGGGTTTGGGGCTGAGGAGG + Intronic
1103961642 12:124612629-124612651 GGGAGGGGCTGGGAGTCAGAAGG - Intergenic
1104104141 12:125643075-125643097 ACGTGTGTCTGGGGCTCAGAAGG + Intronic
1104175987 12:126333104-126333126 GGCTGGGCTTGGGGTTCAGATGG + Intergenic
1104914574 12:132258051-132258073 GGGTGGGTCTGCTGCTGAGAGGG - Intronic
1104968805 12:132521919-132521941 GGGCGGGTCTGGGGAGCAGGTGG + Intronic
1105278262 13:18948579-18948601 GGGTGGGTCCAGGGAGCAGAGGG - Intergenic
1105540722 13:21313939-21313961 GTCTTGGTCTGGGGTTTAGAAGG + Intergenic
1109345894 13:61113971-61113993 GGCTGGGTCTGGGGTTTTTATGG - Intergenic
1109572189 13:64207149-64207171 GGCTGCGTCTGGGGTTCTTATGG + Intergenic
1110150825 13:72251179-72251201 TGGTGGGACTGGGGTTCATTAGG - Intergenic
1110691156 13:78430716-78430738 GGTTGGGTAGGGGCTTCAGATGG + Intergenic
1112441706 13:99428790-99428812 GGGTGGCTAAGGGTTTCAGATGG - Intergenic
1113254988 13:108496223-108496245 GGGTAGGTCCAGAGTTCAGAAGG - Intergenic
1113582685 13:111440112-111440134 GGGTGCCTCTTGGGTGCAGAGGG + Intergenic
1113871828 13:113564606-113564628 GGGAGGGTCTGCGGGTCTGAGGG - Intergenic
1113871993 13:113565262-113565284 GGGAGGGTCTGTGGGTCTGAGGG - Intergenic
1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG + Intergenic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1115528142 14:34301884-34301906 GGGTGGGGCTGGGGCTGGGATGG - Intronic
1116064558 14:39966424-39966446 TGATTGGTGTGGGGTTCAGAGGG + Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1118734015 14:68689607-68689629 GGGTGGGAGTCGGGTTCACAAGG - Intronic
1121253926 14:92517956-92517978 GGGCTGGGCTGGGGTACAGAGGG - Intronic
1121279895 14:92690685-92690707 GGGTGGAGCTGGGGTTCAGAGGG + Intergenic
1122291890 14:100685353-100685375 GGGTGGGGCGTGGGGTCAGACGG + Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122859264 14:104575226-104575248 GGGTCTGTCTGGGCTTCAGTGGG - Intronic
1123053848 14:105560137-105560159 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1123078431 14:105680554-105680576 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1124181658 15:27481447-27481469 GGTAGGGTGTGGGGTGCAGATGG + Intronic
1124209329 15:27750064-27750086 GGGTGGGCTTGTGGATCAGAGGG - Intergenic
1124632390 15:31345096-31345118 GGTTGGGTCTGGGTTCCATAGGG + Intronic
1125060102 15:35409179-35409201 GGGTGGTGCTGGGGTTGGGAGGG + Intronic
1125722802 15:41853222-41853244 GGGTGGGCCTGGGGTTGGGCTGG - Intronic
1125832868 15:42728913-42728935 GGGTGGGTGTGGGGCTGAAATGG - Intronic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1127013413 15:54655537-54655559 TTGGGGGTCTGGGGATCAGACGG - Intergenic
1127733627 15:61821909-61821931 TGGTGGGTCTGGCTTTCAGCAGG - Intergenic
1128451332 15:67807449-67807471 GGGTGGGGCTGGGGTGGAGAAGG - Intergenic
1128527391 15:68421717-68421739 GTGAGGGGCTGGGTTTCAGATGG + Intronic
1129453723 15:75664831-75664853 AGGTGGGCCTGAGGTTCAGGGGG - Intergenic
1130017824 15:80201310-80201332 GGAGGGGGCTGGGGTTCAGGTGG + Intergenic
1130131910 15:81150689-81150711 AGGTGGGTTTGGGCTTCAGCTGG + Intergenic
1130209743 15:81912289-81912311 GGAAGGGTGTGGGATTCAGAGGG - Intergenic
1132112501 15:99112557-99112579 GTCTAGGTCTGGGATTCAGAAGG + Intronic
1132664060 16:1073638-1073660 GGGTGGGTCTGGGGTGGGGGAGG - Intergenic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1133234287 16:4380586-4380608 AGGAGGGCCTGGGGTTCAGGAGG + Intronic
1133239907 16:4408105-4408127 GGATGGCGCTGGGGCTCAGAAGG + Intronic
1134117623 16:11561083-11561105 AGGTGGGTCTGGGGCTGTGACGG - Intronic
1134214676 16:12307874-12307896 TGGTGGGCCAGGAGTTCAGAAGG - Intronic
1135547466 16:23375712-23375734 GGGAGGGTAGGGGGTTCATAAGG - Intronic
1135595028 16:23735264-23735286 GTGTGTGTGTGTGGTTCAGAAGG + Intergenic
1135931801 16:26744383-26744405 GGGTGACTCTGGGGTGCAGATGG - Intergenic
1136092937 16:27933717-27933739 GGGAGGTTCTGGGGTTCTGAGGG - Intronic
1136269452 16:29139823-29139845 GGGTGGCTCTGGTGTTAAGGAGG + Intergenic
1136518916 16:30784098-30784120 GGGGGGTTCTGGGGGACAGAGGG + Exonic
1136519022 16:30784575-30784597 GGGTGGGAGTGAGGTTCAGGGGG - Intronic
1137319933 16:47370377-47370399 GGCTGGGTCTGGGGTTTTTATGG - Intronic
1138486763 16:57350236-57350258 GGGTGGGGCAGGTGCTCAGAGGG - Intergenic
1139100451 16:63760466-63760488 GGGTGGGTGCGGGTTTCAGGAGG - Intergenic
1139532354 16:67548597-67548619 GGGTGGGTGTGAGGATCGGAAGG + Intergenic
1140457451 16:75113509-75113531 AGCTGGGGCTGGGGTACAGATGG - Intronic
1142032775 16:87846742-87846764 GGGTGGGTCTCAGCTTCAGAGGG - Intronic
1142072931 16:88101093-88101115 GGGTGGCTCTGGTGTTAAGGAGG + Intronic
1142144460 16:88487135-88487157 GGATGTGTCTGGGGTACAGCTGG - Intronic
1142147130 16:88497392-88497414 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142147149 16:88497437-88497459 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142147169 16:88497482-88497504 GGGCGGGGATGGGGTTCAGAGGG + Intronic
1142147189 16:88497527-88497549 GGGCGGGGATGGGGTTCAGCGGG + Intronic
1142560411 17:806119-806141 GGGGAGGGCTGGGGTGCAGACGG - Intronic
1142560429 17:806165-806187 GGGTTGTGCTGGGGTGCAGACGG - Intronic
1142560446 17:806211-806233 GGGTTGTGCTGGGGTGCAGACGG - Intronic
1142560463 17:806257-806279 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142560481 17:806302-806324 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142666700 17:1467652-1467674 GGGTGGATTTGGGGGTCAGGAGG - Intronic
1143483812 17:7242052-7242074 TGGTGGATGTGGGGTTGAGAGGG - Intronic
1144377701 17:14661860-14661882 GGGTGGGACTGGGGTACAGCAGG - Intergenic
1144708942 17:17387945-17387967 GGCTGGCTCTGGGCTCCAGAAGG + Intergenic
1144710905 17:17400982-17401004 GCGTGTGTCTGGGGTCCCGATGG + Intergenic
1144739903 17:17576076-17576098 GGGTGGTCCTGGGGCTCAGCGGG - Intronic
1144835797 17:18156087-18156109 AGGTGGGGCTGGGCTTCAAATGG + Intronic
1145260523 17:21352007-21352029 GGGTGGGTTTAGGGAGCAGAGGG + Intergenic
1146208110 17:30922143-30922165 GGGTGGGCCTGGGGTCCGGCCGG - Intronic
1147364891 17:39953080-39953102 GGGTGGGGCTGGGGCCGAGACGG + Intergenic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147944156 17:44070846-44070868 GGCGGGGCCTGGGGCTCAGAGGG + Exonic
1148156150 17:45426144-45426166 GGGTGGGGCTTGGGGTCAGGGGG + Intronic
1148360710 17:47010121-47010143 GGGTGAGTCTGGGTCCCAGAAGG + Intronic
1148491105 17:48024394-48024416 GTGTGGGCCAGGGGTTCGGATGG + Intergenic
1149848659 17:60022115-60022137 GGGTGGGTTTGGGGGTGGGAAGG - Intergenic
1149861510 17:60124409-60124431 GGGTGGGTTTGGGGGTGGGAAGG + Intergenic
1150141584 17:62734295-62734317 GGGTGGGTGTGGGGAGCTGAAGG + Intronic
1150141595 17:62734336-62734358 GGGTGGGTGAGGGGCTCAGGAGG + Intronic
1151155985 17:72123321-72123343 GGGAGGGTCTGGGGCCCGGAGGG - Intronic
1151522677 17:74641553-74641575 GGGTGGGGCTGGGGTGCACTGGG - Intergenic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1152250179 17:79208390-79208412 GGGTGGGGCTGGGAGTCAGTCGG + Intronic
1152636547 17:81432740-81432762 GGGTGGGTCTGGGGCTCGGGGGG - Intronic
1152636560 17:81432764-81432786 GGGTGGGCCTGGGGATGGGAGGG - Intronic
1152677894 17:81651043-81651065 GGGAGGGTCTGGACTTCAGCAGG + Exonic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152863494 17:82709316-82709338 GGGTGGGTCATGGGGGCAGAGGG - Intergenic
1153643442 18:7174730-7174752 GTGTGGGTGTGGGGTGCTGAAGG - Intergenic
1155341425 18:24818059-24818081 GGGTGGGTCAGGGGTGGAAAAGG - Intergenic
1156458019 18:37305594-37305616 GGGTGGTGCTGGGAGTCAGATGG + Intronic
1159334368 18:67044070-67044092 GGGTTTTTCTGGGCTTCAGAGGG - Intergenic
1160289035 18:77573155-77573177 GGCTGGGTCTGGGGTACTGGTGG - Intergenic
1160761715 19:788854-788876 GGGTGGGGCGGGGGCACAGAGGG - Intergenic
1160949153 19:1657479-1657501 GGGTGGATCTGGGGTACATTTGG + Intergenic
1161288973 19:3482880-3482902 GGGGGAGGCGGGGGTTCAGAGGG + Intergenic
1161672774 19:5623424-5623446 GGGTGGGTCTGGGGTCCTCTTGG + Intronic
1161849270 19:6730501-6730523 GGGTGAGTCTGGGGTAGAGTGGG - Intronic
1162001612 19:7747714-7747736 GGGATGGTCTGGGGTTGACAGGG + Intergenic
1162003463 19:7763042-7763064 GGGATGGTCTGGGGTTGACAGGG - Intergenic
1162333415 19:10045043-10045065 GGGCTAGTCTGGGGGTCAGAGGG - Intergenic
1162638402 19:11987982-11988004 GGGTGGGTCTGGGCGGCAGTCGG + Intergenic
1162774361 19:12969991-12970013 GGGTGGGTGTGGGGAGGAGAGGG + Intronic
1163762005 19:19142341-19142363 GCTGGGGTCTGGGGTGCAGATGG + Intergenic
1165063288 19:33215442-33215464 GGCAGGGGGTGGGGTTCAGAGGG + Intronic
1165281832 19:34804342-34804364 GGTTGGGTCTGGGGAAAAGAGGG - Intergenic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1166639434 19:44482553-44482575 GGGTGGGGGTGGTGTTCAGGAGG - Intronic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167157960 19:47750702-47750724 CGTTGAGTCTGGGGCTCAGAGGG + Intronic
1167550145 19:50154770-50154792 GGGTGGGTATGGGGCTAAGGAGG - Intronic
1168119903 19:54246060-54246082 GGGTGCACCTGGGGTGCAGATGG - Intronic
1168229246 19:55018475-55018497 GTGGAGCTCTGGGGTTCAGAAGG - Intronic
1168641754 19:58035342-58035364 GGGTGTGTCTGGGGTCTATATGG - Intronic
1168724154 19:58571502-58571524 GGGTAGGTCTGAGGATCAAACGG - Intronic
925722668 2:6843851-6843873 GGCTGGCTCTGGTGTCCAGAAGG + Intronic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
925981200 2:9178875-9178897 GGTTGGGTTTGGGGTGCTGAGGG + Intergenic
925982524 2:9188918-9188940 GGTGGGGCCTGGGGTGCAGATGG - Intergenic
927462642 2:23312463-23312485 GTGTGGTTCTCGGGTGCAGATGG - Intergenic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
927748354 2:25643302-25643324 GGGAAGCACTGGGGTTCAGAAGG - Intronic
927875640 2:26653610-26653632 GGGTGTGGCTGGGGTGCAGTGGG - Intergenic
928434063 2:31242331-31242353 GTGTGGGTGTTGGGTACAGAAGG + Intronic
931414876 2:62071740-62071762 AGGTGGCTCTGGGGTTCCCATGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932316191 2:70785087-70785109 GGGTGGTTCTGGGGTTAAATAGG + Intronic
932486143 2:72085433-72085455 AGGTGGGTCTGGGGAACAGTGGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
934619151 2:95793565-95793587 GGGTGGGAATGGGGCACAGATGG + Intergenic
934641740 2:96030992-96031014 GGGTGGGAATGGGGCACAGATGG - Intronic
935098000 2:99965715-99965737 GGCTGGGCCTTGGGCTCAGAAGG - Intronic
936094953 2:109524234-109524256 GGGAGGACCTGGGGCTCAGAGGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937027472 2:118711382-118711404 GGGTTCTTCTGGGGTTCAGAGGG - Intergenic
937262356 2:120594716-120594738 GGGTGGGTCTCTGTTGCAGAGGG + Intergenic
937274974 2:120678557-120678579 GAGTTGGTCGGGGGTGCAGATGG + Intergenic
937865833 2:126751433-126751455 GGGTGGGTAGGGGATACAGATGG - Intergenic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
941404834 2:165074987-165075009 GGCTGGGTCTGGGGTTTTTATGG - Intergenic
942585046 2:177466307-177466329 GGGTTTTTATGGGGTTCAGAGGG + Intronic
943960488 2:194256511-194256533 GGGTGGGAATGGGTTTCAGGAGG + Intergenic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
947523440 2:230865148-230865170 GAGAGGGTCTGGGGCTCAGGCGG + Intronic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
947824839 2:233098671-233098693 GGGATGGCCTGGGGTTAAGAGGG - Intronic
947911068 2:233801316-233801338 GGGTGGGGGTGGGGTGGAGAGGG + Intronic
948236561 2:236395133-236395155 GGGTGGGAAGGGGGCTCAGATGG + Intronic
1169083138 20:2809718-2809740 GGGTGGGAGTGGGTTTCAGGAGG + Intergenic
1169809266 20:9592878-9592900 GGGTGGGTGGCTGGTTCAGAGGG + Intronic
1170350828 20:15439203-15439225 GGCTGGGTCTGGGGTACATTCGG - Intronic
1170819594 20:19745021-19745043 GGTTGGGTATGGGTTTCAGATGG + Intergenic
1171320784 20:24242318-24242340 GGATGGGGCTGGGGTCCTGAGGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1172800633 20:37573881-37573903 GGGTGTGTGCTGGGTTCAGAGGG + Intergenic
1172852980 20:37979992-37980014 GGGTGGCTGTGGTCTTCAGAAGG - Intergenic
1172894073 20:38287140-38287162 GGGTGGGTCGGGGATTGGGAGGG - Intronic
1172968844 20:38858835-38858857 ACATGGGTCAGGGGTTCAGATGG + Intronic
1173184791 20:40832246-40832268 GGGTGGGGCAGGGGTTCACTTGG - Intergenic
1173495524 20:43514864-43514886 GGGTGGTCCTGGGGTGGAGAAGG + Intronic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173711725 20:45163271-45163293 GGGTGGGTCTGGTATTTACAAGG + Intergenic
1174201853 20:48811934-48811956 AAGTGGGTCTGCGGTTGAGATGG - Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175686399 20:61031545-61031567 GGGGCGGGGTGGGGTTCAGATGG - Intergenic
1175806409 20:61831661-61831683 GGGTGGGCCTGGGGTCCTGAGGG - Intronic
1175902456 20:62365508-62365530 GGGGTGGTCTGAGGTTCACAGGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1179723516 21:43329317-43329339 GGGTGGGTGTGGGGTGATGAGGG + Intergenic
1179904269 21:44414085-44414107 GGGTGGGGCTGGCGTGCAGGTGG + Intronic
1180105239 21:45614098-45614120 GGGTGGGTCTGGCTCTCAGCTGG - Intergenic
1181056038 22:20260955-20260977 GGGTGGGAGTGGGGTGCACAGGG - Intronic
1181533126 22:23528437-23528459 GGGTGGGGCTGGGGTTTGGGGGG + Intergenic
1181559433 22:23691685-23691707 GGGTGGATTTAGGGTTCTGAAGG + Exonic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1181695920 22:24592802-24592824 GGGAGGGTCTGGGGGTCTGGGGG - Intronic
1181762416 22:25067452-25067474 GGGTGGGGTAGGGGTTCTGATGG - Intronic
1181967010 22:26663887-26663909 GGCTGGGACTGGGGCTGAGAGGG - Intergenic
1182093692 22:27612500-27612522 GGGTGGTTGTGGGGTGCAGTGGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182719543 22:32386335-32386357 GGGTGGATTTAGGGTTCTGAAGG + Intergenic
1183018074 22:35006295-35006317 GGGTGGGGGTGGGGGTCTGAGGG + Intergenic
1183727916 22:39599694-39599716 GGGTGGGTCTGGGGTCCGAGTGG + Intronic
1183832328 22:40424933-40424955 GCCTGGCTCTGGGCTTCAGATGG + Intronic
1184252347 22:43267966-43267988 GGATGGGCCTGGGCTCCAGATGG + Intronic
1184271224 22:43385379-43385401 GGGTGGGTCAGGGCTCCAGGAGG + Intergenic
1184474445 22:44712916-44712938 GGGAGGGGTTGGGGGTCAGAGGG + Intronic
1185296629 22:50058053-50058075 AGGCGGGTCTGGGGTTCCGAAGG + Intergenic
1185308314 22:50136256-50136278 GGGAGAGTCTGTGGTGCAGATGG + Intronic
1185384883 22:50527046-50527068 GGGTGGGACTGGGGTTAGGCAGG + Intronic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950167305 3:10811190-10811212 AGGAGGGTCTGGGGTTCTGGAGG - Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951790264 3:26474775-26474797 GGGAGTGTCAGGGCTTCAGAAGG - Intergenic
952657350 3:35801966-35801988 GGGTTTTTATGGGGTTCAGAAGG + Intergenic
952971207 3:38651300-38651322 TGGGGTGTCTGGGGTACAGACGG + Intergenic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
953447545 3:42980561-42980583 TGCTGGGCCTGGGGTTTAGAAGG + Intronic
953977690 3:47394796-47394818 GGGTGTGTGTGTGTTTCAGAAGG + Intronic
954320938 3:49831624-49831646 GGGTGGGTCTGGGCTGGAGAGGG - Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
955370622 3:58348345-58348367 GTCTGGTTCTGTGGTTCAGAAGG - Intronic
955972719 3:64451831-64451853 GGGTGGGCCTGGGGTTCCGAAGG + Intergenic
956903751 3:73744130-73744152 TGGTGGGTCTGAGGGTCAGCTGG + Intergenic
957161164 3:76611013-76611035 GGCTGGGTCTGGGGTTATGCTGG + Intronic
957694603 3:83618761-83618783 GGGTGGGAGTGGGTTTCAGGAGG + Intergenic
960639728 3:119813739-119813761 GGTTTGGAATGGGGTTCAGATGG + Intronic
961144847 3:124585015-124585037 GGATGGGGCTGGGGATCAGGAGG + Intronic
961365222 3:126395238-126395260 GGGTGAGCCTGGGGTTCGCAGGG - Intronic
963285258 3:143428913-143428935 GGGTGGGGATGGGGATCAGGAGG + Intronic
965481026 3:169219656-169219678 GGGTGGGTGTGTGGTGTAGAAGG + Intronic
966234605 3:177686758-177686780 GGGAGTGTCTGGGGGTGAGAAGG - Intergenic
967098021 3:186193613-186193635 GAGCGGGCCTGGGGTTCTGAAGG - Intronic
968084097 3:195866978-195867000 GGCTGGGTCTGCGGCCCAGAGGG - Exonic
968895720 4:3401975-3401997 GGGTGGAGCTGGGGCTCAGGGGG - Intronic
969297298 4:6277633-6277655 TGCTGGGCCTGGGGTTCAGCGGG - Exonic
969697726 4:8744597-8744619 GGCTGGGCATGGGGTTCAGCTGG - Intergenic
969967063 4:11007935-11007957 GGAGAGGACTGGGGTTCAGAGGG + Intergenic
974542494 4:63256035-63256057 GGGTGGGTTTGGGGAGGAGAAGG - Intergenic
975488722 4:74965347-74965369 GTGGGGATCTGGGGTACAGATGG + Intronic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
977189881 4:93986419-93986441 TGGTGGGTGTAGGGTTGAGAAGG - Intergenic
977806793 4:101309159-101309181 AGGTGGGGCTGGGGTTGGGAAGG - Intronic
978195671 4:105969088-105969110 GAGTGGGTCAGTGGGTCAGAAGG + Exonic
978638234 4:110837569-110837591 GGGTGGGGGTGGGGACCAGAAGG + Intergenic
979670690 4:123357414-123357436 GGCTGGGGCTGGGTTTCAGGAGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
982181353 4:152751329-152751351 GGTTGGGGGTGGGCTTCAGAGGG - Intronic
982945465 4:161616697-161616719 GGGTGGGAGTGGGGTGCAGTGGG + Intronic
983661396 4:170133649-170133671 AGGTGGGAGTGGGGTTCAGGAGG + Intergenic
985781809 5:1875588-1875610 GGGAGGGGCTGGGGTCCCGAGGG + Intergenic
985783243 5:1881630-1881652 GGGTGGGGGTGGGGTTCTGAGGG + Intronic
985834571 5:2261113-2261135 GGGTGGCTCTGTGGCTGAGACGG + Intergenic
988088821 5:26508357-26508379 GGCTGGGTCTGGGGTTTTTATGG - Intergenic
990116612 5:52399014-52399036 GGGTGGTTTTGTCGTTCAGATGG + Intergenic
992190341 5:74285611-74285633 GGGTGGTGGTGGGGTTCAGGTGG - Intergenic
992619006 5:78574267-78574289 GGCTGGGCCTGGTGTACAGAGGG - Intronic
993328135 5:86566980-86567002 GGATGGGTCTGGTTATCAGATGG - Intergenic
994406541 5:99352538-99352560 GGCTGAGTCTGGGGTTTATATGG + Intergenic
996776346 5:127136507-127136529 GGTTGTGTCTGAGTTTCAGAAGG - Intergenic
999231948 5:150066851-150066873 GGGTGGGGTTGGGGGTCTGAAGG - Intronic
1000182891 5:158829588-158829610 GGATGGGGATGGGGTTGAGAAGG + Intronic
1000338004 5:160255749-160255771 GGGTGGGCCTGGGATTCCAAGGG - Intronic
1001454877 5:171852861-171852883 GGATGGGTCTGGGCTTCAGCAGG + Intergenic
1001949370 5:175805620-175805642 GGGTGGGTCTAGTGGTCAGGGGG + Intronic
1002538927 5:179893529-179893551 GGATGGGTCTGGGGTACAGATGG - Intronic
1003412499 6:5877882-5877904 GTCTTGGTCTGGGGTTTAGAAGG - Intergenic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1004281190 6:14281045-14281067 GGGAGGGTCTGGGGTAGAGGTGG + Intergenic
1005302765 6:24486976-24486998 GGGTGGGTGTGGGGTGTAGTTGG - Intronic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1005952764 6:30643613-30643635 GAGTGGGTCTGAGGTTCTCAGGG - Intronic
1006298264 6:33179610-33179632 GGGTTGGTTTGGGGTTAACAGGG - Intronic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007388837 6:41538093-41538115 GGGTGGGTCAGGGGTACACTGGG - Intergenic
1007937068 6:45741890-45741912 GGGCGGGGCTGGGGTGGAGAAGG - Intergenic
1011790564 6:90894086-90894108 GGGTGGGACTGGGCTTTGGATGG + Intergenic
1013097722 6:106961170-106961192 GGGTCGGTCTGTGGCTCAGAAGG + Intergenic
1013304279 6:108833559-108833581 GGGTGGGTGGGGGGTGCTGAGGG + Intergenic
1016111331 6:140229496-140229518 GGGTGGTTCTTGGATTCAGTTGG + Intergenic
1017784826 6:157746909-157746931 GGGTGGGTCGTGGGGTCAGAGGG + Intronic
1019006385 6:168800116-168800138 TAGTGGAACTGGGGTTCAGAGGG + Intergenic
1019446097 7:1072125-1072147 GGGAGGGTCTGGGTATCGGAAGG - Intronic
1019452339 7:1106294-1106316 GTGTGTGTCTGGGCATCAGAGGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020176010 7:5882666-5882688 GAGTGGGCCTGGGGTGCAGTGGG + Intronic
1020939166 7:14509454-14509476 GGGTGGGAGTGGGTTTCAGGAGG - Intronic
1022183854 7:27948038-27948060 GGGTGGGTGTGGCCTGCAGATGG + Intronic
1022472969 7:30693001-30693023 GGGTGGCTGTGGGGCTCAGGAGG + Intronic
1023350238 7:39313211-39313233 TGATGGGTCTGGGGATCAGGAGG - Intronic
1023838668 7:44082910-44082932 GGCTGGGTCTAGGGTTGAGCCGG + Intergenic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863203 7:44227396-44227418 GGGAGAGTCTGGGGGACAGAGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1024330196 7:48147603-48147625 GGGTGGGAGTGGGTTTCAGGAGG + Intergenic
1028053084 7:86208668-86208690 GGGTTTTTGTGGGGTTCAGAAGG + Intergenic
1028244583 7:88461821-88461843 GAGAGGGTCTGGGCTTCAGTTGG - Intergenic
1029082816 7:97988353-97988375 GGGTGGGCCTGGGGTGCAGTGGG - Intronic
1029661943 7:101968310-101968332 GGTTGAGTCTGGGGTCCAGGTGG + Intronic
1030570308 7:111213613-111213635 GGGTGAGTCTGGGGTTCTTGTGG - Intronic
1032076342 7:128837900-128837922 GAGTGGGGCTGGGGTGCATAAGG + Intronic
1032310956 7:130786766-130786788 GAGTGGCTCTGGGGTCCAGGTGG + Intergenic
1033597575 7:142868071-142868093 GGGTGGGGCTGGGGAACACATGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034628968 7:152515881-152515903 GGCTGGGCCTGTGGGTCAGATGG - Intergenic
1034997123 7:155584586-155584608 TGGTGGGTTGGGGGTTCCGATGG - Intergenic
1035142613 7:156777892-156777914 GGTAGGGTATGGGGTTCAGCAGG - Intronic
1035259736 7:157653795-157653817 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259758 7:157653871-157653893 GGGTGGGTGTGGGGATCAGCGGG - Intronic
1035259779 7:157653947-157653969 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035270784 7:157718859-157718881 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035271079 7:157720357-157720379 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035553148 8:545028-545050 GGGCGGGTCTGGTCTTCGGAAGG - Intronic
1037768234 8:21784652-21784674 GGATGGGCCTGGGGTACAGAAGG + Intronic
1038319765 8:26515120-26515142 GGGAGGGGCGGGGGTTCGGACGG + Intronic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1039350874 8:36762151-36762173 GGGTGGATCTGGGGATTAGTAGG + Intergenic
1040481608 8:47832166-47832188 GAGTTGGGCGGGGGTTCAGAAGG - Intronic
1040735677 8:50504988-50505010 GGGTGGGTCTGGGGAAAATAGGG - Intronic
1041552746 8:59119464-59119486 GGGTGGGGCGGGGATCCAGAAGG + Intergenic
1043195533 8:77287584-77287606 GGCTGAGTCTGGGGTTCTTATGG - Intergenic
1045063724 8:98427825-98427847 TGGTGGGTCTTGGGTGCTGAAGG - Intronic
1045562915 8:103283297-103283319 GGGTGGGTATGGGGGTCCTAGGG - Intergenic
1048429709 8:134358769-134358791 GGGTGGTTCTGGAGTGCACATGG - Intergenic
1048934502 8:139343803-139343825 GGTTGGGGTGGGGGTTCAGAGGG + Intergenic
1049165566 8:141123568-141123590 GGAGGGTTCTGGGGTTTAGAGGG + Intronic
1049974342 9:847150-847172 TGGAGGGGCTGGGGTTCACATGG + Intronic
1052048541 9:23821736-23821758 GGGTGGGGCGGGGGTTCCGCCGG - Intronic
1053429971 9:38035619-38035641 GGGTAGGTCTTGGGGACAGAAGG + Intronic
1053886837 9:42650027-42650049 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054225856 9:62457477-62457499 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1055593654 9:77843886-77843908 GGATGGGTCTGTGGCTCAGAGGG + Intronic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1056982396 9:91327479-91327501 GGGTGAGTCTGGGGTTTTTATGG - Intronic
1057194338 9:93108462-93108484 GGGGGAGGCTGGGGTTCTGAGGG - Intronic
1057214654 9:93221045-93221067 GGGTGGGCCTGGGGTGGGGAGGG + Intronic
1060424018 9:123489703-123489725 GAGTGGGGCTTGGGTTCAGTGGG + Intronic
1060839443 9:126782192-126782214 GGGTGTGCCTGGGGTTCATGGGG + Intergenic
1061133890 9:128722624-128722646 GGGTGGGGTTGGGGTGCAGTTGG + Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062075323 9:134585440-134585462 GGGCAGGGCTGGGCTTCAGAGGG + Intergenic
1062240960 9:135537790-135537812 GAGAGGTTCTGGGGTGCAGAGGG - Intergenic
1062290560 9:135792505-135792527 GGGTGGGGCTGGGGTGCATGGGG + Exonic
1062417495 9:136459736-136459758 GGGTAGGTCAGGGGTGGAGATGG - Exonic
1062565131 9:137160943-137160965 GGGTGCGTCGGGGATTAAGAGGG + Intronic
1186614466 X:11172109-11172131 GGATGAGAGTGGGGTTCAGAGGG - Intronic
1187292637 X:17969863-17969885 GGGTGAGTCTGGTGCTAAGAAGG + Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1188915076 X:35900847-35900869 GGGTGGGGCGGAGGTTGAGATGG - Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1192219319 X:69186435-69186457 GGGTGGATCTGGGGTTCAAAGGG - Intergenic
1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG + Intergenic
1195991150 X:110683737-110683759 GGATGAGCCTGGGGTTCAGATGG - Intronic
1196887907 X:120264769-120264791 GGGTGGGTCTGTGCTTCAGGTGG + Intronic
1198642418 X:138770881-138770903 GGGTCGGTGTGGGGTGGAGAAGG + Intronic
1200049756 X:153422504-153422526 GGTGGGGTCTGGGGAGCAGAAGG - Intergenic
1200862412 Y:8006969-8006991 GGGTGGGAATGGGTTTCAGGAGG + Intergenic
1200873378 Y:8126534-8126556 GGGTGGGAGTGGGTTTCAGGAGG + Intergenic
1202174529 Y:22085281-22085303 GGGTGGGAGTGGGTTTCAGGAGG - Intronic
1202216831 Y:22501101-22501123 GGGTGGGAGTGGGTTTCAGGAGG + Intronic
1202326356 Y:23694969-23694991 GGGTGGGAGTGGGTTTCAGGAGG - Intergenic
1202544416 Y:25975085-25975107 GGGTGGGAGTGGGTTTCAGGAGG + Intergenic