ID: 953423683

View in Genome Browser
Species Human (GRCh38)
Location 3:42774484-42774506
Sequence CAGGATAAAGAGTAGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953423683 Original CRISPR CAGGATAAAGAGTAGGATTC AGG Intronic
901724297 1:11228631-11228653 GAGGAGAAAGAGAAGGATTGGGG + Intronic
902743253 1:18455136-18455158 AAGGATACAGAATAGGATTAGGG - Intergenic
902809320 1:18879383-18879405 CAGGAGAAAGGGTGGGGTTCAGG + Intronic
903673975 1:25053023-25053045 TAGGAAGAAGGGTAGGATTCAGG - Intergenic
903691105 1:25174237-25174259 CAGGAAACAGAGTAAGGTTCCGG + Intergenic
903771418 1:25766784-25766806 CAGAAGAAAGTGTGGGATTCAGG - Intronic
905597695 1:39222474-39222496 TTGGATAACGAGTAGGATTCTGG - Intronic
905770005 1:40631294-40631316 CAGGACCAAGCGTAGGCTTCAGG + Intronic
908391065 1:63684004-63684026 CAGGACAAAGATTTGGATGCAGG - Intergenic
908478518 1:64513029-64513051 CAGAATAAAGATTTGGACTCTGG - Intronic
909061873 1:70888277-70888299 AAGGATAAATAATAGGCTTCTGG + Intronic
909680626 1:78287586-78287608 TAGGATAAAGAAGAAGATTCTGG - Intergenic
915600390 1:156919960-156919982 CAGGGTCTAGAGTAGGAGTCAGG + Intergenic
917493677 1:175520624-175520646 AAGGATACAGAGTTTGATTCTGG + Intronic
918453697 1:184685645-184685667 CAGGAAAAAGAGAAGGCTCCTGG - Intergenic
921742158 1:218697634-218697656 CAGGTTAAAGAGGAGGATTGAGG - Intergenic
923146542 1:231202540-231202562 CAGCATGCAGAGTAGGACTCCGG - Intronic
923501194 1:234566191-234566213 CAGTACAAAGGGAAGGATTCTGG - Intergenic
1063437755 10:6048369-6048391 GAGGAGAAAGAGTAGGTTCCAGG + Intronic
1063903538 10:10760276-10760298 CAGGATAAAGAGGGGGACTGGGG - Intergenic
1064716098 10:18178130-18178152 GAGGATATAGAGTTGAATTCGGG + Intronic
1064764062 10:18652935-18652957 CAGGATAAAGACTAGTAATTTGG + Intronic
1065692083 10:28344927-28344949 CAGAATTAAGAGTATGATTTTGG + Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1067958800 10:50824232-50824254 CATGATAATTAGTAGGATCCGGG + Intronic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1074013116 10:109504610-109504632 CAGGATGAGGAGTTGGATTGTGG - Intergenic
1076011595 10:126993506-126993528 TAGGATAAGGAGTAGTATTTGGG + Intronic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078812936 11:14788658-14788680 CAGGAGAAACTGCAGGATTCTGG - Intronic
1081775347 11:45672286-45672308 CAGGAGAAAGAGTAGCAACCAGG + Intergenic
1082309310 11:50627277-50627299 CAGGATAAAAACTAGGAGTAAGG + Intergenic
1083948179 11:65937757-65937779 CAGTAAATAGAGTAGGAATCAGG - Intergenic
1087998246 11:104839105-104839127 CATGGTGAAGAGTGGGATTCAGG - Intergenic
1088446696 11:109938062-109938084 CAGGAGAAAGAGGAGGCTTTGGG - Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097867053 12:64567628-64567650 CAGCATGAAGACTAGGATTTTGG + Intergenic
1098473331 12:70870423-70870445 CAGAATAAAGAGTAGCAGTAGGG - Intronic
1098962407 12:76752713-76752735 CAGCAAAGAGAGCAGGATTCAGG + Intergenic
1101325957 12:103716202-103716224 AAAGATAAAGTGTGGGATTCTGG - Intronic
1106148383 13:27073191-27073213 CAGGAGAAAGAGTAAGACCCTGG + Intronic
1106879562 13:34114533-34114555 AAGGATAAAGAGTTGGTGTCTGG + Intergenic
1108076091 13:46680985-46681007 CAAGAGGAAGAGTGGGATTCAGG + Intronic
1108278650 13:48838969-48838991 CAGGAAAAAAAGTAGGTATCTGG + Intergenic
1112344701 13:98579375-98579397 CAGGACACAAACTAGGATTCCGG - Intergenic
1114338777 14:21721074-21721096 CAGCAGATAGAGAAGGATTCAGG - Intergenic
1116925982 14:50638009-50638031 CAGCATCAAGAGTACGATTATGG + Intronic
1117225407 14:53653536-53653558 CAATATAGTGAGTAGGATTCTGG - Intergenic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117938519 14:60935679-60935701 CAGGAATAAGAGTATGATGCAGG + Intronic
1120273518 14:82344251-82344273 TAGGAGAAAGGGGAGGATTCAGG - Intergenic
1120474508 14:84970092-84970114 CAGGATAGAGGGCAGCATTCGGG + Intergenic
1121582655 14:95042378-95042400 AAGGAAAAAGAGCAGGGTTCTGG - Intergenic
1123166221 14:106327533-106327555 TAGGATATGGAGGAGGATTCTGG - Intergenic
1123168910 14:106352561-106352583 GAGGATATGGAGGAGGATTCTGG - Intergenic
1128694000 15:69746936-69746958 CATAATAAACAGTAGGATTCTGG + Intergenic
1128971890 15:72115467-72115489 CAGGATAAAATCTAGGTTTCTGG - Intronic
1129633354 15:77287669-77287691 CAGGTGAAAGGTTAGGATTCAGG - Intronic
1131320564 15:91386070-91386092 CAGGAGCAAGAATAGCATTCTGG - Intergenic
1134858065 16:17537227-17537249 AATGAGAAAGAATAGGATTCTGG - Intergenic
1135073344 16:19371505-19371527 CAGGGTAAAAATCAGGATTCAGG + Intergenic
1135566850 16:23517615-23517637 CTGGACCAAGAGTAGGAGTCAGG - Intronic
1135736543 16:24936266-24936288 CAGGATAGAGATCAGAATTCAGG + Intronic
1137667787 16:50261780-50261802 CAGGATGAAGAGGAGCCTTCAGG - Intronic
1138412934 16:56853950-56853972 CAGGAGAAACAGCAGGACTCAGG + Intergenic
1138489056 16:57365572-57365594 CAGGCTAAAGACTGGGATTTGGG + Exonic
1139038593 16:62977397-62977419 CAGGAGAGAGAGGAGGATCCAGG + Intergenic
1139469614 16:67171034-67171056 CAGGATAAAGGGCAGGACTTGGG + Intronic
1139703691 16:68725752-68725774 CAGGTAGAAAAGTAGGATTCAGG + Intergenic
1141726046 16:85789182-85789204 CAGAAGAAAGGGTAGGACTCAGG + Intronic
1147839117 17:43357948-43357970 CAGGATAAAGATGAGAATCCAGG - Intergenic
1148511228 17:48171613-48171635 GAGGAAAAGGATTAGGATTCTGG - Intronic
1149450624 17:56747481-56747503 CAGGATAAAGAGTAGGTCTTGGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1154031408 18:10756889-10756911 CAGGATAAAAAGGAGGAATGGGG + Intronic
1155999742 18:32371598-32371620 CAGGAAGAAGAGTGGGATTAAGG + Intronic
1157631189 18:49097747-49097769 CACAAGAAAGAGTAGAATTCAGG - Intronic
1158366284 18:56740722-56740744 GAAGATAAGAAGTAGGATTCAGG - Intronic
1159223356 18:65495734-65495756 CAGGATTCAGAGTAGGATGGAGG + Intergenic
1159697913 18:71584042-71584064 CAGTATCAAGAGTAGGATGCTGG - Intergenic
1160073130 18:75645664-75645686 CAGAAGAATGAGGAGGATTCCGG + Intergenic
1161816078 19:6501081-6501103 GCGGATACAGAGAAGGATTCAGG - Intronic
1163159296 19:15455252-15455274 CAAGATATAAAGTAGGATTGGGG + Intronic
1164302786 19:23976646-23976668 CAGGATAAAAGGTAAGATCCTGG - Intergenic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1168561847 19:57390739-57390761 CAGCATAAAGAGCAGATTTCCGG + Intronic
1168700799 19:58438396-58438418 GAAGATAAAGAGTTGGATTTTGG - Intronic
925018516 2:550603-550625 CAGTGTACAGAGCAGGATTCTGG + Intergenic
927042295 2:19241531-19241553 CAGGATAAAGAGAAGACTACAGG + Intergenic
927072381 2:19544367-19544389 CAGGACAAAGAGTAATAATCTGG - Intergenic
928847157 2:35690139-35690161 CATGATAAAGAGAAAGAATCAGG - Intergenic
929111350 2:38407650-38407672 CAGGAGAAAGGGAAGGCTTCAGG - Intergenic
930899536 2:56486765-56486787 CAGAATAAATTGTAGGATTGAGG - Intergenic
931825578 2:65997122-65997144 CAAGATCAAGAGTAGAATTCTGG - Intergenic
932529778 2:72516540-72516562 TTGGATTAAGAGTAGAATTCAGG - Intronic
932685850 2:73869057-73869079 CAGGATAAAGAGTATACTACTGG + Intronic
934834225 2:97568378-97568400 CAGGATACAGAGTAGGGTCAAGG + Intronic
935074217 2:99724703-99724725 ACGGATAAAGAGTGAGATTCAGG - Intronic
935153493 2:100461316-100461338 CAGGAGAAAGTGCAGGACTCAGG + Intergenic
937396379 2:121539325-121539347 CAGGATAAAGAAACAGATTCGGG + Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939662460 2:144907075-144907097 AAGGATAAATAGTAACATTCGGG - Intergenic
939997932 2:148937624-148937646 GAGGATAAAGGGTAGAATTTGGG - Intronic
940735065 2:157441654-157441676 GAGGATAAAGAGAGGGATTTTGG - Intronic
941336184 2:164246425-164246447 CAGGTTCAAGAATAGGATTAGGG - Intergenic
943128688 2:183828953-183828975 AAGATTAAAGAGTAGGATTTGGG + Intergenic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
944201920 2:197116893-197116915 CAGGAGGAAGAGTAGGCTTAGGG - Intronic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
946307940 2:218866488-218866510 CAGGACAAACAGTAGGGTGCAGG - Intronic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947576242 2:231277163-231277185 CAGGGAAAAGAGTGTGATTCAGG - Intronic
1177194837 21:17892980-17893002 CAGGATAAAGAAGAGAATACAGG - Intergenic
1177967014 21:27740363-27740385 CTGGATAAAAAGTAGAACTCTGG - Intergenic
1178789492 21:35686949-35686971 CAGGATGAAGGGTGAGATTCTGG - Intronic
1184053524 22:42027241-42027263 CAGGATAAGGAGGACGACTCAGG + Exonic
950329582 3:12145857-12145879 CAAGTAAAAGGGTAGGATTCAGG + Intronic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
952546094 3:34420959-34420981 CAGGATGAATAGAAAGATTCGGG - Intergenic
953423683 3:42774484-42774506 CAGGATAAAGAGTAGGATTCAGG + Intronic
958147406 3:89643787-89643809 GAAGATAAAGAGTAGAATTATGG + Intergenic
959096590 3:101963332-101963354 AAGGATAAAGAGGAGAATTAAGG - Intergenic
959946816 3:112133946-112133968 CAGGCTAAAGAGTAACATTTGGG - Intergenic
962477358 3:135767091-135767113 AAGGACACAGAGTTGGATTCAGG + Intergenic
965916662 3:173856862-173856884 CAGAATAAACTTTAGGATTCAGG + Intronic
966988995 3:185209800-185209822 GATGTTAAAGAATAGGATTCAGG + Intronic
967161378 3:186741633-186741655 CAAGATGAAGAGCGGGATTCAGG + Exonic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
967452027 3:189635778-189635800 CAGGAAAAAGAGCATGATACTGG - Intronic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
972412836 4:38810423-38810445 CAGGAAATAAAGTAGGAATCAGG + Intronic
972459860 4:39291456-39291478 CAGTATTAAGAGTAGACTTCTGG - Intronic
973020974 4:45206229-45206251 CAGGAAAAAAAGTAGGGTTGAGG - Intergenic
974703422 4:65481399-65481421 TTGGATAAATAGGAGGATTCAGG + Intronic
979963648 4:127051171-127051193 CAGGAAATAGAATAGCATTCAGG + Intergenic
980490626 4:133522577-133522599 CAGGAGACAAAGTAAGATTCTGG + Intergenic
982273090 4:153611400-153611422 AAGGATAAAGACTTGGATTCTGG - Intronic
983731451 4:170998969-170998991 CAGGATTAGCAGTAGGACTCAGG + Intergenic
984429064 4:179625205-179625227 CAGGATAAAAAGTAGGTATTTGG - Intergenic
985285837 4:188335852-188335874 CAGGATAAAGGGGAGCATTGGGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992157095 5:73966356-73966378 AAGGATAATGAGTAGGATATTGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
995354900 5:111225683-111225705 GAGGATCCAGAGCAGGATTCTGG + Intronic
996996030 5:129697612-129697634 CATGATACAGAGTAGTAATCAGG + Intronic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997648954 5:135500998-135501020 CAGGGTCAAGAGTTGGTTTCAGG - Intergenic
1003525363 6:6892448-6892470 CCCACTAAAGAGTAGGATTCTGG + Intergenic
1006170466 6:32089054-32089076 CAGGTTAAAGAGGAGGACTCAGG + Intronic
1007183168 6:39945237-39945259 CAGGAGAAAGTGTGGTATTCTGG - Intergenic
1007209595 6:40181700-40181722 CAGGGTAAGAAGTAGGATTAGGG + Intergenic
1008402386 6:51078674-51078696 GAGGATCAGGAGTAAGATTCAGG - Intergenic
1008452806 6:51672507-51672529 GATGATAAAGATTAGGTTTCAGG - Intronic
1008966685 6:57319784-57319806 CAGGACGAAGAGTAGGAATGAGG + Intronic
1009973608 6:70650793-70650815 CAGGATAAAGCACAGGAGTCTGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1012520855 6:100119555-100119577 CTGGAAAAAGAGGATGATTCGGG + Intergenic
1012589583 6:100964135-100964157 CAGCATTATGAGTAGTATTCTGG + Intergenic
1016562723 6:145414972-145414994 CAGGAGACAAAGTAGGATACGGG - Intergenic
1016815216 6:148297143-148297165 CAGCACAGAGAGTAGGACTCTGG + Intronic
1017531544 6:155297365-155297387 CAGGAAAAAGAGTTGGCTTGAGG + Intronic
1019872177 7:3774776-3774798 CTGGACAAAGAGTAACATTCAGG - Intronic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021778025 7:24073093-24073115 AAGGGTGAAGAGGAGGATTCAGG - Intergenic
1023002462 7:35824401-35824423 CAGCATACAGAGTAGGAAGCAGG - Intronic
1027993174 7:85390052-85390074 CAGAATAAACACTAAGATTCTGG + Intergenic
1028414846 7:90568711-90568733 CAAGATAAATGGTAGAATTCAGG + Intronic
1028444520 7:90905149-90905171 CAGGATAAAGAAGAGAATCCAGG + Intronic
1028605783 7:92653928-92653950 AAGGATAAAGAATAGAAATCTGG - Intronic
1030596786 7:111549637-111549659 CATGAGAAATAGTAAGATTCTGG + Intronic
1030668375 7:112307160-112307182 CAGGAGAAAGACTAGGAATAGGG - Intronic
1033862997 7:145652314-145652336 CAGGAAAAAGAGTACGAGACAGG - Intergenic
1036060480 8:5312846-5312868 CAGGATACAGAGTCACATTCTGG + Intergenic
1038417946 8:27411266-27411288 AATGATAAAGAAGAGGATTCAGG + Intronic
1039152655 8:34524464-34524486 CAGGGTAAAGGATAGGATTTAGG - Intergenic
1039790338 8:40870860-40870882 CAGGCTAAAGAAGAGGATGCTGG + Intronic
1041205748 8:55496228-55496250 ATGGATAAAGATTAGGACTCTGG + Intronic
1042348370 8:67750626-67750648 CAGGATGAAGAGTGGCATTCGGG + Intergenic
1043007011 8:74832264-74832286 CAAAATAAAGAGCAGAATTCTGG + Intronic
1043082707 8:75785368-75785390 GAGGAGAAAGAGGAGGGTTCAGG - Intergenic
1043215925 8:77587900-77587922 AAGGATGAAGAGTAGGATGATGG - Intergenic
1045069447 8:98486085-98486107 CAGGCTAAAGATTTGAATTCTGG + Intronic
1046315392 8:112494729-112494751 CTGTATAAAGAGAAGCATTCAGG + Intronic
1046876487 8:119260276-119260298 CAGTAAAAAAAGTAGGAATCAGG - Intergenic
1047171550 8:122498093-122498115 GAGGATAGAGAGTGGGATTAGGG - Intergenic
1047893409 8:129338050-129338072 AAGGAAAAAGAGAAGGATTTGGG - Intergenic
1048042262 8:130742689-130742711 CAGGATTCAAAATAGGATTCTGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1052018142 9:23493282-23493304 CAAGATTAAGAGAAGCATTCAGG + Intergenic
1053120858 9:35546767-35546789 CAGCACCAAGAGTAGGAGTCGGG + Exonic
1055592166 9:77828427-77828449 CAGGAGGATGGGTAGGATTCTGG - Intronic
1056296691 9:85200456-85200478 GAGGAAACAGAGTAGGATTGGGG - Intergenic
1186441606 X:9591741-9591763 CATGATAAAGAGGAGGTTTCTGG + Intronic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1186974559 X:14887516-14887538 CAGGATATAGAGTAGAATGATGG - Intronic
1187807891 X:23141108-23141130 CAGAATAATGGGTAGGATTTAGG - Intergenic
1189676255 X:43463752-43463774 AAGGATAAACCATAGGATTCTGG + Intergenic
1190158847 X:48016070-48016092 CAGGAAAAAGAGTAGCATTTGGG + Intronic
1190174546 X:48138351-48138373 CAGGAAAAAGAGTAGCATTTGGG + Intergenic
1190229854 X:48573937-48573959 GAGGAGAAAGAGTAGGAGTCAGG + Intergenic
1191267003 X:58406764-58406786 CAGGATAAAAATTAGAATTAAGG + Intergenic
1191945559 X:66531024-66531046 CAGGATAAACAGTTGGTTTGAGG + Intergenic
1192606763 X:72526743-72526765 CAGGAGGAAGAGTGGGTTTCAGG - Intronic
1192947967 X:75986118-75986140 CCAGATTAGGAGTAGGATTCAGG - Intergenic
1194591191 X:95801905-95801927 CAGGAGAAAGGATAGGCTTCTGG + Intergenic
1198082607 X:133253322-133253344 CAGACTAAAAAGTAGCATTCTGG + Intergenic
1198722081 X:139633857-139633879 CAGGAATAAGAGTAGAATTTAGG + Intronic
1199814589 X:151386513-151386535 GAGGATATAGACTAGGATTGTGG + Intergenic