ID: 953428126

View in Genome Browser
Species Human (GRCh38)
Location 3:42812578-42812600
Sequence GTTTGCTTGCTTACCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953428122_953428126 4 Left 953428122 3:42812551-42812573 CCTTCCTGAGAACTAGCCCAGTG 0: 1
1: 0
2: 0
3: 17
4: 135
Right 953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 154
953428123_953428126 0 Left 953428123 3:42812555-42812577 CCTGAGAACTAGCCCAGTGCTCT 0: 1
1: 0
2: 2
3: 18
4: 198
Right 953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953428126 Original CRISPR GTTTGCTTGCTTACCTCTCC AGG Intronic
900100109 1:958854-958876 GTTGGGTTGCTGACCTCGCCTGG - Intronic
900340571 1:2186768-2186790 GTTTGCTTGTTAACCACTTCTGG - Intronic
901947434 1:12715195-12715217 CTGTGCTTGCTTGCCTTTCCAGG - Intergenic
902039856 1:13484655-13484677 GTTTTCATGCTTTCCTCTCTTGG + Intronic
904397341 1:30230711-30230733 GTTTCCTTTCTGTCCTCTCCTGG - Intergenic
904802337 1:33102526-33102548 GTTTTCATGCTCACCTCTCCTGG + Intronic
905668944 1:39778721-39778743 TCTTTCTTGCTTACATCTCCTGG - Intronic
906559767 1:46747881-46747903 GTTTCCATGCTTCCCTCTGCTGG - Intergenic
907149333 1:52268624-52268646 TTTTGTTTTCTTACCTCTGCTGG - Exonic
907937686 1:59057405-59057427 TTTTGCTTATTTACCTCCCCTGG - Intergenic
912202240 1:107471419-107471441 GTTTGCATCCGTACCTCCCCTGG + Intronic
912475852 1:109934312-109934334 GTTTGCTGGTTTCCCTCTTCAGG + Intergenic
916809906 1:168296175-168296197 GTATGCTTTTCTACCTCTCCAGG + Intronic
916989365 1:170225935-170225957 GTTGGCTTGCCTGCCTCTGCAGG + Intergenic
919630410 1:199955082-199955104 ATTTGCTTGGTTTTCTCTCCAGG + Intergenic
921333854 1:214066534-214066556 GTTGCCCTGCTTATCTCTCCAGG - Intergenic
922542930 1:226432916-226432938 GGCTGCTGGCTTACCTCTGCAGG + Intergenic
923027088 1:230213229-230213251 GTTTCCTTGTCTGCCTCTCCGGG - Intronic
923217060 1:231858059-231858081 GTTTGCTTGGATGCTTCTCCAGG - Intronic
924101587 1:240608912-240608934 GTTTGCATGCTGCCCTCTCCTGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063332082 10:5169957-5169979 GGTTGCTTCCTTAGCTTTCCAGG + Intergenic
1063807018 10:9656973-9656995 GATTGCTTTCTTTGCTCTCCAGG + Intergenic
1064249417 10:13695531-13695553 GTTTGCTTGTTTTCTTCTTCAGG + Intronic
1064610794 10:17099971-17099993 TTTTGCTTGCTTTTTTCTCCAGG + Intronic
1068237114 10:54251393-54251415 TTGTACTTGCTTACTTCTCCTGG + Intronic
1071454660 10:85836792-85836814 CTTGGCCTGCTTACCTCTCCTGG + Intronic
1077925160 11:6674618-6674640 GTTTGTGTGCTTACATTTCCAGG - Intergenic
1078085831 11:8232571-8232593 GTTTGAGTGCGTACCTCTGCTGG - Intronic
1078667662 11:13339843-13339865 GTTTGCTTGCCTTCCTCACCAGG + Intronic
1078862094 11:15257986-15258008 GTTCCCTTTCCTACCTCTCCAGG - Intergenic
1084445391 11:69200632-69200654 GTTTGCCTCCCTCCCTCTCCAGG - Intergenic
1087055977 11:93936676-93936698 CTTTGCTTGCTTTGCTCTGCTGG + Intergenic
1092935562 12:13360377-13360399 GTTTGCTTTCTGAGGTCTCCTGG + Intergenic
1093656328 12:21698618-21698640 GTTTTCTTGTTTAACTATCCTGG + Intronic
1096257121 12:50070194-50070216 GTCTGCTTGGGCACCTCTCCAGG + Intronic
1098903407 12:76136073-76136095 GTTTGATTGCTTATCTCTCTAGG - Intergenic
1100816518 12:98392075-98392097 GTTTGGTTGGTTTCCTCTTCTGG + Intergenic
1104611085 12:130228346-130228368 GATTGCTTCCTTGCCCCTCCTGG - Intergenic
1106127799 13:26914666-26914688 GTGTGCTTGCTTACCACATCAGG - Intergenic
1106568721 13:30907809-30907831 TTTTGTTTGCTTCCCTCTCTTGG - Intronic
1107089114 13:36457319-36457341 TTTTGCATTCTTACCTCCCCTGG - Intergenic
1107533724 13:41308560-41308582 GTGTGCTTGCTCAGTTCTCCGGG + Intergenic
1113220065 13:108089964-108089986 GTGTCCTTCCTTGCCTCTCCTGG - Intergenic
1115109635 14:29806077-29806099 CTTGCCTTGCTTTCCTCTCCTGG - Intronic
1116359163 14:43971368-43971390 GTTTGTTTGCTTTTTTCTCCTGG + Intergenic
1120985578 14:90331827-90331849 GTTTGTGTGCTTACCTTTCCTGG + Exonic
1124007016 15:25802607-25802629 GTATGCTTCCCTGCCTCTCCTGG + Intronic
1129379295 15:75155184-75155206 GTTTGCTTGGTTTCCCCTGCGGG - Intergenic
1131446828 15:92505766-92505788 CTTTGCTAGCTGACCTCTACAGG + Intergenic
1132085836 15:98907691-98907713 GTCTGCTTTCTTGCCTCTCCAGG + Intronic
1133600200 16:7332840-7332862 ATTTTCTTTCTTTCCTCTCCCGG + Exonic
1139202459 16:64991935-64991957 TGTTGCCTGCTTACCTGTCCAGG - Exonic
1139891190 16:70254138-70254160 CTTTCCTTGCTTTCCTTTCCAGG - Intronic
1140816622 16:78627236-78627258 GTTTGCTACCATACCTCCCCAGG + Intronic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1142889872 17:2936318-2936340 CTTTGCTTGGTTGCCTCCCCTGG + Intronic
1146589623 17:34117539-34117561 GTTCCCTAGGTTACCTCTCCTGG - Intronic
1147896889 17:43757086-43757108 GTTTGCATCCTCACCTCTGCAGG + Intronic
1151175883 17:72287716-72287738 GTTTGCATTCTTCCCTCTACTGG - Intergenic
1153973239 18:10245448-10245470 GTTGGCTTGTTTACCCCTCAGGG + Intergenic
1157750318 18:50172741-50172763 GTTTGCTTGTCTTCCTCACCTGG - Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
927993535 2:27465518-27465540 CTTTGCTTCCTTCCCTTTCCAGG - Exonic
928171072 2:29003336-29003358 GACTGCTTCCTTACCACTCCTGG - Intronic
928804791 2:35137931-35137953 TTTTCCTTGCTTACCTCTTTTGG + Intergenic
933190319 2:79327060-79327082 GCTTTCCTGCATACCTCTCCAGG + Intronic
933738807 2:85516865-85516887 AGTTGTTTGCTTACCTTTCCTGG + Intergenic
933746021 2:85571923-85571945 GTTTGCTTGGTTGCCTTTTCAGG + Intronic
941454249 2:165696359-165696381 GTTTGATTGCTTCCTCCTCCTGG - Intergenic
941765927 2:169296482-169296504 AATTGCTTGCTGACCTCACCTGG - Intronic
943012426 2:182466558-182466580 GTTTCCATCCTCACCTCTCCAGG - Intronic
946037462 2:216755446-216755468 GATTTCTTGCTCACATCTCCAGG + Intergenic
948310507 2:236982123-236982145 GTATCCTTGCTTCCTTCTCCTGG + Intergenic
1169818805 20:9686692-9686714 GTTTGCTTCCATACCTCTGCAGG + Intronic
1173043461 20:39487760-39487782 GGTTGCTTCCTTAGCTTTCCAGG - Intergenic
1173261868 20:41443722-41443744 TTTTTCTTGCTTCCCTTTCCTGG + Intronic
1174821406 20:53729626-53729648 GTTTGCCTTCTTACTTCTCCTGG + Intergenic
1177343414 21:19835725-19835747 GTTTGCTTGTTTACCTACACAGG + Intergenic
1178928437 21:36795074-36795096 ATTCGCTGGCTGACCTCTCCTGG - Intronic
1179466904 21:41581816-41581838 GCTTGCTTGCTTCCCTCTGGTGG - Intergenic
1183452164 22:37902650-37902672 GTTTACTTGTTTACAGCTCCTGG + Intergenic
950116895 3:10456805-10456827 GGATGTTTGCTTTCCTCTCCTGG + Intronic
950717222 3:14857582-14857604 GTTTCCTTGCTGAAGTCTCCCGG - Intronic
950805727 3:15601639-15601661 GTTTACATTCTCACCTCTCCCGG - Exonic
951175786 3:19598336-19598358 GATTGCTTGGTTTCCTCTCTTGG - Intergenic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
953568619 3:44053979-44054001 GGTTTCTTGCTCCCCTCTCCTGG - Intergenic
955851456 3:63224456-63224478 TTTTCCTTACTTCCCTCTCCTGG - Intergenic
957465069 3:80579041-80579063 GTTTGCTTGCTTGCTTCTTTAGG + Intergenic
960076773 3:113495074-113495096 TTTTGTGTTCTTACCTCTCCAGG - Intronic
960654604 3:119989287-119989309 GGTTGCTTCCTTAGCTTTCCAGG - Intronic
960752088 3:120966561-120966583 GTTTGCTGGAATTCCTCTCCAGG + Intronic
961606902 3:128102331-128102353 GTCTGCCTGCTTATATCTCCAGG + Intronic
962028767 3:131576663-131576685 TTTTGCTTCCTGACCTATCCTGG - Intronic
963080879 3:141392792-141392814 TTTTGCTTTCTTACCTTCCCTGG + Intronic
963751595 3:149185446-149185468 GTTTTCTTATTTACCACTCCAGG - Exonic
965459104 3:168939760-168939782 GGTTGCTAGCTTCTCTCTCCTGG + Intergenic
965919516 3:173895380-173895402 GTTTCATTGCTTTCCTTTCCGGG - Intronic
968692416 4:2000224-2000246 GTTTGCTCTCTTGCCTCTCTGGG - Intronic
970309996 4:14772116-14772138 GATGACTTGCTTACCACTCCTGG + Intergenic
973316101 4:48762015-48762037 GTTAGCTCTCTTGCCTCTCCTGG - Intronic
978744269 4:112174245-112174267 GTTTTCTGGGTTACCTCTCCTGG - Intronic
980021170 4:127711877-127711899 GCTTGCTTGCTTTTCTATCCAGG + Intronic
980096458 4:128496337-128496359 ACTTGCTTTCTTTCCTCTCCTGG + Intergenic
980262704 4:130473490-130473512 GTTTTCTTGCTTAACTTCCCTGG + Intergenic
981850009 4:149218862-149218884 GTTGGTCTGCTGACCTCTCCAGG + Intergenic
983029163 4:162777600-162777622 ATTTGCTTGCTTTTCTCTGCAGG - Intergenic
984156235 4:176198777-176198799 GTTTGTTTGTTTAGCACTCCTGG + Intergenic
986274640 5:6263109-6263131 ATTTGCTTGCTTATCACTCCTGG - Intergenic
986494681 5:8330640-8330662 GTTGGCTTGCTTGCTTATCCGGG - Intergenic
986928090 5:12783224-12783246 GTTTCCTCACTTACCTCTCAGGG + Intergenic
988193272 5:27966137-27966159 TTTTATTTGCTTACATCTCCTGG - Intergenic
988457968 5:31404463-31404485 GTTGGCCTGCTTGCCTTTCCTGG + Intronic
989101601 5:37828474-37828496 CTTTGCTTGCTTAATTTTCCTGG + Intronic
990453797 5:55963221-55963243 TTTTGCTTGATAACCTCTTCTGG - Intronic
990825826 5:59896432-59896454 GTGTGCTGGATTAGCTCTCCTGG - Intronic
995148151 5:108810379-108810401 ATTTCCCTGCTCACCTCTCCAGG + Intronic
997794709 5:136796936-136796958 GTATGCTGGCTTTCTTCTCCTGG + Intergenic
1000118648 5:158176237-158176259 GTTTTCCTGGTTCCCTCTCCTGG - Intergenic
1003367374 6:5487836-5487858 CTTTACTTGCTTACGTCACCTGG + Intronic
1007300018 6:40860755-40860777 ATTTCCCTGGTTACCTCTCCTGG - Intergenic
1007691436 6:43704099-43704121 GTTTCCATGCTTGCCTCTTCCGG - Intergenic
1009456483 6:63862521-63862543 GATTGTTTACTTCCCTCTCCTGG - Intronic
1009923122 6:70087761-70087783 GTTTTCTTGCTTTCTTCCCCTGG - Intronic
1010516615 6:76780740-76780762 TTGTACTTGCTTACATCTCCAGG + Intergenic
1012221280 6:96652217-96652239 GTTTCCTTTCTTGCCTCTTCAGG - Intergenic
1012378598 6:98591891-98591913 GTTTTCATGCCTCCCTCTCCAGG - Intergenic
1012427852 6:99133980-99134002 GTTTGCTTTATTAGCTCTCCTGG - Intergenic
1012837310 6:104285933-104285955 GTTGGCTTTCTCACCTCTCTTGG - Intergenic
1015816896 6:137219959-137219981 GTCTGCTCTCTTACCTCTCTGGG + Intergenic
1015962462 6:138664172-138664194 ATGTGCTTGCCAACCTCTCCTGG + Intronic
1016200690 6:141403589-141403611 GTTAGCGTGCTTCCCTCTCTTGG - Intergenic
1016920473 6:149288373-149288395 GTCTGCTTGCTGCCGTCTCCTGG - Intronic
1017091156 6:150760305-150760327 GTCTGCTTCCTTACCTGGCCTGG + Intronic
1018246546 6:161829698-161829720 CTTTGCTTTCTTTGCTCTCCGGG - Intronic
1018380597 6:163255040-163255062 GTTAACTTGCTAACCTCTCAGGG - Intronic
1018637348 6:165874861-165874883 ATTTGCTTCCTCACTTCTCCAGG + Intronic
1021128484 7:16881930-16881952 ATTTGCTTGCTTACCTGACTTGG + Exonic
1023451059 7:40285831-40285853 GTTAGATTGCTAAGCTCTCCAGG - Intronic
1023898753 7:44457318-44457340 ATTTTCTTGCTTAACTCCCCTGG - Intronic
1024568919 7:50708562-50708584 GTTAGCTTGGTTTCCTCTCCAGG + Intronic
1026471224 7:70695068-70695090 GCTCGCTTGCCTACCTCTCGCGG + Intronic
1027164426 7:75824313-75824335 GGGTGCTTGCTTACCTCCCTTGG - Intergenic
1029939958 7:104469605-104469627 GTTTTCCTGCTTACCCCACCTGG + Intronic
1032059335 7:128710969-128710991 GTTTCTTTGCTTACCTCTTTCGG + Intronic
1032946055 7:136854203-136854225 GTTTGCTTGTTTGCTTTTCCGGG + Intergenic
1034517603 7:151592806-151592828 GTTTGCTTTCTTAGCTCTTGAGG + Intronic
1034532556 7:151705720-151705742 GTCTCCCTGCTTAACTCTCCAGG + Intronic
1041100234 8:54389711-54389733 GTTTGCTTGTTTTACTCTGCAGG - Intergenic
1042842244 8:73135689-73135711 GTTTTCTTTCTGAGCTCTCCAGG - Intergenic
1047028457 8:120850257-120850279 ATTTGCTAGCCTTCCTCTCCTGG - Intergenic
1047976715 8:130137966-130137988 GTTTCATTGCTTATTTCTCCAGG - Intronic
1051739340 9:20236266-20236288 GGCTGCTTGCTTACCTGTCAGGG - Intergenic
1052540586 9:29806773-29806795 GCTTGCTGGCTTACCTTTCTTGG + Intergenic
1058584278 9:106490268-106490290 TTTTGCTTGCCTACTTGTCCTGG - Intergenic
1059170051 9:112116336-112116358 GTTTGGTTGCTTTTCCCTCCAGG + Intronic
1059634361 9:116156949-116156971 GTTTGCTGCCTGACCTCTGCTGG + Intronic
1060590575 9:124813872-124813894 GTTTGTTTGTTTACCTGTCTTGG + Exonic
1061653050 9:132066544-132066566 TTTTCCTTGCTGACTTCTCCAGG - Intronic
1187383962 X:18830693-18830715 TTTTGCTTGGTTACCTGCCCAGG + Intergenic
1189203756 X:39220099-39220121 GGATGCTTCCTTACCTCTTCTGG + Intergenic
1193837587 X:86364455-86364477 GATTGCTTCCTCATCTCTCCAGG - Intronic
1194250696 X:91571212-91571234 GATTGCTTGCTTATCTCTCCAGG - Intergenic
1195386133 X:104314897-104314919 TTTTGATTGCTTACCTGTCGGGG + Intergenic
1195641147 X:107176013-107176035 GTCTTCTTGCTTACCTCTTCAGG - Intronic
1197098679 X:122625667-122625689 GTTTACTTGCTTTCCTTTACAGG - Intergenic
1197478688 X:126955003-126955025 ATCTGCTTGATTACCTCTTCTGG + Intergenic
1198565275 X:137897611-137897633 GTGCCCTTTCTTACCTCTCCTGG - Intergenic
1198782263 X:140250281-140250303 GGTTGCTTTCTTCCCACTCCAGG + Intergenic
1199787233 X:151116397-151116419 GTGTGCTTGCTTTCCCCACCAGG + Intergenic
1200569639 Y:4812461-4812483 GATTGCTTGCTTATCTCTCCAGG - Intergenic