ID: 953430477

View in Genome Browser
Species Human (GRCh38)
Location 3:42835678-42835700
Sequence GACTTCGTAGTGGCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953430477_953430480 26 Left 953430477 3:42835678-42835700 CCCACTGTGGCCACTACGAAGTC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 953430480 3:42835727-42835749 TGTAATCTGTGCTTTTTCCTTGG 0: 1
1: 1
2: 4
3: 43
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953430477 Original CRISPR GACTTCGTAGTGGCCACAGT GGG (reversed) Intronic
906788647 1:48639006-48639028 GACTTCATAGTCTCCCCAGTTGG + Intronic
917452008 1:175155075-175155097 GACTTCGTTGTGGGCAGAGGCGG + Intergenic
918255967 1:182747586-182747608 AATTAAGTAGTGGCCACAGTTGG - Intergenic
920052287 1:203171438-203171460 GAGCTCGTAGCGGCCAGAGTCGG + Exonic
920915723 1:210256461-210256483 GACTTCAAAGTGGGCACAGCAGG + Intergenic
921953497 1:220958144-220958166 GACTTCTTAGTGTCCTCACTTGG + Intergenic
1064523851 10:16232183-16232205 GATTTTGTAGGTGCCACAGTTGG - Intergenic
1067236733 10:44457424-44457446 GAGCTCCTAGTGGCCACAGGTGG + Intergenic
1068717870 10:60208084-60208106 AACTTTGTAATGGCCACAGTGGG + Exonic
1076265642 10:129107812-129107834 GATTTCGTAGCTGCCACATTTGG - Intergenic
1077443350 11:2578827-2578849 GCCTTCGGGGTGGCCACAGCGGG + Intronic
1081258648 11:40930322-40930344 GACTTCCTAATGGCCAAAGTGGG + Intronic
1083479418 11:62934061-62934083 GACTGCAGAGTGGCCAGAGTGGG - Intergenic
1084234266 11:67776292-67776314 GACTCCGTTGTGGACATAGTAGG - Intergenic
1084691287 11:70728361-70728383 GACTTGGGAGTGGTCACACTCGG + Intronic
1090123241 11:124055292-124055314 CACTTCATTGGGGCCACAGTAGG - Intergenic
1098585008 12:72144205-72144227 GACTTTTTAGGGGCCACGGTAGG + Intronic
1102221416 12:111197418-111197440 GACTTTGCGGTGGCCACTGTTGG + Intronic
1111895515 13:94136903-94136925 GAAATGGTAGTGGCCATAGTGGG + Intronic
1112997812 13:105595989-105596011 AACTTTGTGGTGACCACAGTTGG - Intergenic
1124627062 15:31314077-31314099 GATTTGGGAGTGGCTACAGTGGG - Intergenic
1129726090 15:77902519-77902541 GACTTCCGAGTGGCCACAGGTGG + Intergenic
1133895761 16:9927372-9927394 GACTTCTTTGTGGCCAAATTAGG - Intronic
1138453884 16:57109940-57109962 AGCTTCCTAGTGGCCAAAGTAGG + Intronic
1139505705 16:67397161-67397183 GTCTTCGCTGTGGCCACATTTGG + Intronic
1143700766 17:8658533-8658555 GACTCCGTATTAGCCACAGCAGG + Intergenic
1148179326 17:45592290-45592312 GAATTATTAGGGGCCACAGTGGG + Intergenic
1148269842 17:46254232-46254254 GAATTATTAGGGGCCACAGTGGG - Intergenic
1150767125 17:68011089-68011111 GAATTCTTAGGGGCCACAGTGGG + Intergenic
1160158297 18:76450584-76450606 GAGTTCGTGTTGGCCACAGAAGG - Intronic
1163161890 19:15469822-15469844 GGCTTCGGCGTGGCCATAGTGGG - Exonic
1166031939 19:40137923-40137945 CACTTCATAGAGGCCACAGTAGG + Intergenic
926926176 2:17989872-17989894 GACTTCCTAATGGCCAAAGCAGG + Intronic
927697029 2:25245791-25245813 GACTCCCCAGTGGCCACAGAAGG - Intronic
929078612 2:38099263-38099285 GACTTTGTGGGGGCCACTGTGGG - Intronic
930852176 2:55972994-55973016 CACTTAGTAGTGACCACGGTTGG + Intergenic
938408392 2:131045240-131045262 GACTCAGTACTGGCCACAGCGGG - Intronic
945100814 2:206260887-206260909 GGCTTTGTAGTGGCCATAATGGG + Intergenic
945562323 2:211354151-211354173 GAACTCTTAGTGGCCACAGATGG + Intergenic
1169809721 20:9597131-9597153 GGCTTCATAGTTGCCACAGATGG - Intronic
1174275546 20:49401134-49401156 GCCTTCGGAGTAGCCACAGCAGG - Intronic
1176311315 21:5152008-5152030 GAACACGTAGTGGCCACTGTAGG + Intronic
1178420105 21:32436667-32436689 GACTCCGTTGTGGACATAGTAGG + Intronic
1179845735 21:44110027-44110049 GAACACGTAGTGGCCACTGTAGG - Intronic
1180788286 22:18558948-18558970 GACCTCGTACTGCCCACAGCAGG + Intergenic
1181233452 22:21436370-21436392 GACCTCGTACTGCCCACAGCAGG - Intronic
1181245198 22:21498473-21498495 GACCTCGTACTGCCCACAGCAGG + Intergenic
1184579051 22:45400401-45400423 GAGTTCTCAGTGGCCACAGCAGG + Intronic
951025482 3:17824290-17824312 CACTTAGTAGGGGCCACGGTTGG - Intronic
952892887 3:38055417-38055439 GACTTTATAGCAGCCACAGTGGG + Intronic
953430477 3:42835678-42835700 GACTTCGTAGTGGCCACAGTGGG - Intronic
955949447 3:64227365-64227387 GACTTGTTCGTGGCCACACTGGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961883894 3:130082836-130082858 GACTCCGTTGTGGACATAGTAGG - Intronic
963563437 3:146897100-146897122 GCCTTCTTAGGTGCCACAGTTGG + Intergenic
968984541 4:3867958-3867980 GACTTCCCAGGGGCCACAGCAGG - Intergenic
969820881 4:9719464-9719486 GACTCCGTTGTGGACATAGTAGG + Intergenic
970886133 4:20989392-20989414 GACTTGGAAGTGGACACAGGTGG + Intronic
971007864 4:22395627-22395649 TACTTAGTAGTGGACACCGTAGG - Intronic
975206409 4:71648629-71648651 GACTTGAAATTGGCCACAGTGGG + Intergenic
976434230 4:84998572-84998594 GGCTTCATAGTGGGCAAAGTGGG + Intergenic
979684443 4:123496089-123496111 GAGCTTGTAATGGCCACAGTAGG + Intergenic
980336327 4:131478517-131478539 AAATTTGTAGTGCCCACAGTTGG + Intergenic
985656799 5:1136116-1136138 GACTGCGGAGAGGCCACAGGAGG + Intergenic
998815195 5:146006906-146006928 GGCTTCCTAGTTTCCACAGTAGG + Intronic
1000451768 5:161398449-161398471 GACTGCATAGTTTCCACAGTGGG - Intronic
1000714279 5:164621676-164621698 GGATTCGGATTGGCCACAGTTGG - Intergenic
1001151816 5:169236202-169236224 GAATTCTTAGTGGCCAAAGCTGG - Intronic
1001945192 5:175772684-175772706 GACTTAGTCCTGGTCACAGTGGG + Intergenic
1007961728 6:45966461-45966483 GACCTAGTGGTGCCCACAGTGGG + Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1017822036 6:158056588-158056610 GTCTGCCTAGTGGCCGCAGTGGG + Intronic
1019774066 7:2901872-2901894 GGCTTCGTGATGGCCACAGCAGG - Intergenic
1021565236 7:22010221-22010243 GACTTCGTGGTGGGCAGATTTGG + Intergenic
1024587811 7:50856582-50856604 GACTTCATCTTGGCCACTGTAGG + Intergenic
1038085824 8:24195133-24195155 AACTTTGTAGTAGACACAGTGGG + Intergenic
1053169724 9:35869880-35869902 GACCACGTGGTGGCCACAGAAGG + Exonic
1054713646 9:68536456-68536478 GAATTTGTACTGGCCACAGATGG - Intergenic
1056986553 9:91368769-91368791 GAGTTCCCAGTGGCCACAGCTGG + Intergenic
1060970173 9:127733353-127733375 GGCTTTGCAGTGGGCACAGTGGG - Intronic
1189644938 X:43118030-43118052 GAGTTCTCAGTGGCCAGAGTTGG - Intergenic
1190136961 X:47806616-47806638 CACTTGGGAGTGGCCACAGCAGG - Intergenic
1190217276 X:48488356-48488378 GACTTTGTTGTGGACACTGTTGG - Intergenic