ID: 953432928

View in Genome Browser
Species Human (GRCh38)
Location 3:42854507-42854529
Sequence CACTTCCACCTCACGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953432920_953432928 13 Left 953432920 3:42854471-42854493 CCATTTTGAAAGGGAGTGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 999
Right 953432928 3:42854507-42854529 CACTTCCACCTCACGTTGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953432928 Original CRISPR CACTTCCACCTCACGTTGTG AGG Intronic
903708416 1:25303830-25303852 CTCTTTCACCCCACATTGTGGGG + Intronic
903718698 1:25388583-25388605 CTCTTTCACCCCACATTGTGGGG - Intronic
906145250 1:43556824-43556846 CACCTTCAGCTCACGTGGTGAGG - Intronic
909278473 1:73719367-73719389 CACTTGCACCTCACCTTGAGGGG - Intergenic
911740098 1:101377688-101377710 CACTTCCACATCTCCTTGTGTGG - Intergenic
914776972 1:150746158-150746180 TACTTCCTTCTCACGCTGTGAGG - Intronic
916677119 1:167073423-167073445 CACTTCCACCTCCAGTCGAGAGG - Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
1067069586 10:43122001-43122023 CACTTACACATCACTTTGCGTGG - Exonic
1073792537 10:106955002-106955024 CACTGCTACTTCCCGTTGTGTGG - Intronic
1073793295 10:106961556-106961578 CACTTCCATCGCACTTTCTGTGG - Intronic
1078823908 11:14907888-14907910 CACTTCCTCCTCACTGAGTGTGG - Intronic
1083579165 11:63813833-63813855 CACTTCCGCGTCACGGTGCGGGG + Intronic
1087219200 11:95527530-95527552 CACTGCCACCTCACTCTGTTAGG + Intergenic
1087778148 11:102275486-102275508 CATGTCCACCTCACTTAGTGTGG + Intergenic
1091097367 11:132836989-132837011 CACTTCCACTTCTCGTTTTTTGG - Intronic
1091789958 12:3266422-3266444 CCCTTCCTCCTCATGTTCTGTGG - Intronic
1092168199 12:6355848-6355870 CACTTCCACCACCCGATGTATGG - Exonic
1098873168 12:75839411-75839433 CACTTCTACCTTACTTTGTTAGG - Intergenic
1101794030 12:107956353-107956375 ACCTTCCACATCACCTTGTGTGG - Intergenic
1102497658 12:113330508-113330530 CACTCCCACCTCACGGGGTTTGG + Intronic
1103364215 12:120370005-120370027 CACCCCCACCTCCCGGTGTGAGG + Intergenic
1116906367 14:50407708-50407730 AACTACCTCTTCACGTTGTGAGG + Intronic
1117360983 14:54973539-54973561 CACTGCCACCTCATACTGTGTGG - Intronic
1117452657 14:55865893-55865915 CACTTCCACGGCACCTGGTGGGG - Intergenic
1119229722 14:72970503-72970525 CACTGCCACCTCACCCTGTGCGG + Exonic
1121931765 14:97978633-97978655 CACTCCCACCTCCCGTTCTTGGG + Intergenic
1127408851 15:58684467-58684489 CTCTCCCACCTCACTTTCTGGGG - Intronic
1130628736 15:85543369-85543391 CTCTTGGACCTCATGTTGTGGGG + Intronic
1135567252 16:23520862-23520884 CACTGCAACCTCCCGTTCTGTGG + Intronic
1137224397 16:46489510-46489532 AACTTAGACCCCACGTTGTGAGG + Intergenic
1140950498 16:79812437-79812459 TACTTCCACCTTACGCTGGGTGG - Intergenic
1144524240 17:15976684-15976706 CACTAGCACCTCATGTTTTGGGG + Exonic
1144852122 17:18249098-18249120 CACCCCCACCTCACATTGTTGGG + Intronic
1148714868 17:49708701-49708723 CATTTCCACCCCTCGATGTGAGG - Intronic
1151136029 17:71946382-71946404 CACTTCTACCTCACTCAGTGGGG - Intergenic
1158946470 18:62451197-62451219 AAGTTCCACCGCACGTTTTGTGG - Intergenic
1159122276 18:64184892-64184914 CACTTCCAAATCACATTGAGGGG + Intergenic
1162160763 19:8713496-8713518 CAGTTCATCCTCATGTTGTGCGG - Intergenic
1162774848 19:12973294-12973316 CACTTCCACCCCACCTTGACAGG - Intronic
1164760931 19:30727789-30727811 CTCCTCCTCCTCACATTGTGAGG - Intergenic
1165232485 19:34395769-34395791 CAGGTCCACCTCACGGTGTCAGG + Intronic
927740126 2:25561322-25561344 CACTCCCACCACACATTGTGTGG - Intronic
932362142 2:71118098-71118120 CACATCCTCCTCACCCTGTGTGG + Intronic
935968522 2:108507142-108507164 CACTTCAGCCTCACATTGTTGGG - Intronic
937106491 2:119319832-119319854 GACTGCCACCTCACGGTCTGCGG - Intronic
937552143 2:123107577-123107599 CACTGCCACCCCAGGTTATGAGG + Intergenic
938192334 2:129295111-129295133 CACGTCCACATCAGGTAGTGGGG + Intergenic
942288207 2:174442932-174442954 CACTTCGGCCTTAAGTTGTGGGG + Intronic
1168952019 20:1808995-1809017 CACTTCCACAACACCTGGTGGGG + Intergenic
1172949641 20:38714617-38714639 CACTTCCATCTGAGGCTGTGGGG + Intergenic
1173231689 20:41203669-41203691 CTCTTCCAGGTCACGTTGTGGGG - Exonic
1174103384 20:48144486-48144508 AAATTCCACCTCACATTGAGGGG + Intergenic
1174339976 20:49889433-49889455 CTCTTCCACCTCAGGCAGTGTGG + Exonic
1175049439 20:56140747-56140769 CACTCCCACTTCATGATGTGAGG - Intergenic
1184401602 22:44277724-44277746 CACTTCCACCTCAGGCCATGGGG - Intronic
1184866816 22:47205927-47205949 CTCTTGCACTCCACGTTGTGTGG + Intergenic
952911910 3:38197401-38197423 CACTTCTTCCTCACTTGGTGTGG + Intronic
953432928 3:42854507-42854529 CACTTCCACCTCACGTTGTGAGG + Intronic
954352697 3:50058429-50058451 CACTATCACCTCAGGTGGTGTGG - Exonic
954503718 3:51047866-51047888 CACTTCCAACTCATTTTATGAGG + Intronic
955022261 3:55132792-55132814 AACTTCCACCTCACATTGTCAGG - Intergenic
955098093 3:55819982-55820004 CAATTTCACCTCACTTTGAGGGG + Intronic
955303028 3:57801460-57801482 CACCTCCATCTCACCCTGTGTGG - Intronic
961068513 3:123898073-123898095 CATTTCTACCTCAAATTGTGTGG + Intronic
966704044 3:182891169-182891191 CACTTCCACCTGAAATAGTGGGG + Intronic
968613728 4:1568264-1568286 GACTTCCACCTTAAGGTGTGAGG - Intergenic
969071065 4:4539816-4539838 CACTTCCACCTCTCCCTGAGTGG - Intronic
969488878 4:7487415-7487437 CACTTCCCCCTCCCCTTGTCTGG + Intronic
970514577 4:16815461-16815483 CACTTCCATCTAAGGTTATGTGG + Intronic
972063038 4:34905178-34905200 CACTGCCACCTCAAGATGTCAGG + Intergenic
972269923 4:37501435-37501457 CTGTTCCACCTCACGTTATCAGG - Intronic
972975701 4:44632943-44632965 CACCTCCACCTCCTGCTGTGCGG - Intronic
974216981 4:58860817-58860839 CATTTCCTCCTCAGGTTGTAAGG - Intergenic
976404611 4:84649135-84649157 CACTTCCTCCTCATGTAGTCTGG + Exonic
976701615 4:87975573-87975595 CACTTCCCCCTCTGGTTTTGTGG - Intergenic
978606348 4:110484230-110484252 CACTTCCCCATAACGCTGTGAGG + Intronic
982775364 4:159436049-159436071 CACTTTCACCTCAGGTAGAGAGG - Intergenic
984721288 4:182975378-182975400 CAGTTCCACTTCACCTTTTGGGG - Intergenic
984762375 4:183373973-183373995 CACTTCCAACTCATTTTATGAGG - Intergenic
986713178 5:10502573-10502595 CACTGCCACCCCACGGTCTGGGG - Intergenic
993926334 5:93870721-93870743 CACTTCCACCCCCCCTTATGTGG - Intronic
999317522 5:150593977-150593999 CATTATCACCTCACTTTGTGGGG - Intergenic
1001914091 5:175545098-175545120 CACTTCCTCTTAAGGTTGTGGGG - Intergenic
1002930232 6:1629329-1629351 GACTTCCACTTCAGTTTGTGTGG - Intronic
1003837211 6:10084697-10084719 CACTGCCACCTCTCTTTCTGTGG - Intronic
1004445338 6:15692746-15692768 AATTTCCACCCCACGTTGTGGGG + Intergenic
1005644107 6:27825172-27825194 AACATCCACCTCACTTTCTGTGG + Intergenic
1008514408 6:52306285-52306307 CACCTCCACCTCTCCTGGTGGGG - Intergenic
1010201587 6:73287001-73287023 CATTTCTACCTCACTTAGTGTGG - Intronic
1016066959 6:139693796-139693818 CACTTTCACCTGAAGTAGTGGGG - Intergenic
1017341750 6:153332271-153332293 CACTTCCACCTCACTGAATGTGG + Intergenic
1028107355 7:86894928-86894950 CACTTCTATCACAAGTTGTGCGG + Intronic
1032352966 7:131183026-131183048 CACATCCACCTGATGCTGTGTGG - Intronic
1032672429 7:134097676-134097698 CCCTCCCACATCAAGTTGTGGGG - Intergenic
1032794343 7:135265755-135265777 CTCCTCCCCCTCACCTTGTGAGG + Intergenic
1034895807 7:154875707-154875729 CTCTTCCTCCTCACTTTATGGGG + Intronic
1038046980 8:23773848-23773870 CACTGCCACCTCAGCTTTTGGGG + Intergenic
1042505072 8:69550870-69550892 CTTTTCCAGCTCACTTTGTGTGG + Intronic
1044535663 8:93354168-93354190 GACTTCCTCCTCAGGCTGTGAGG + Intergenic
1055241121 9:74187734-74187756 CACTTCCATGTCACGTAGTATGG - Intergenic
1059905278 9:118977104-118977126 CTCTTTCGCCTCATGTTGTGAGG - Intergenic
1062306555 9:135910406-135910428 CACTTCCAACTCATTTTATGAGG - Intergenic
1062542948 9:137049560-137049582 CACTTCCATCTTCCCTTGTGTGG + Intronic
1195740037 X:108055440-108055462 CACTTCCAACTCATTTTATGAGG + Intronic
1199473638 X:148222392-148222414 CACAACCACCTCATGTGGTGAGG + Intergenic