ID: 953433029

View in Genome Browser
Species Human (GRCh38)
Location 3:42855178-42855200
Sequence GACTCCTTTTTGTAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953433023_953433029 13 Left 953433023 3:42855142-42855164 CCACCACACCCAGCCTTCAATCA 0: 1
1: 7
2: 93
3: 805
4: 4234
Right 953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 128
953433024_953433029 10 Left 953433024 3:42855145-42855167 CCACACCCAGCCTTCAATCACAC 0: 1
1: 0
2: 3
3: 64
4: 562
Right 953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 128
953433026_953433029 4 Left 953433026 3:42855151-42855173 CCAGCCTTCAATCACACCTTTCT 0: 1
1: 0
2: 0
3: 22
4: 410
Right 953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 128
953433027_953433029 0 Left 953433027 3:42855155-42855177 CCTTCAATCACACCTTTCTCAGT 0: 1
1: 0
2: 0
3: 17
4: 277
Right 953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 128
953433025_953433029 5 Left 953433025 3:42855150-42855172 CCCAGCCTTCAATCACACCTTTC 0: 1
1: 0
2: 1
3: 23
4: 198
Right 953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953433029 Original CRISPR GACTCCTTTTTGTAACTGCT AGG Intronic
901072539 1:6529000-6529022 GACTCCAATCTGTGACTGCTTGG - Exonic
904764355 1:32831810-32831832 GACTCCTTTTTTTATATCCTAGG + Intronic
909664527 1:78118475-78118497 CACTCATTTATGTTACTGCTTGG + Intronic
912195094 1:107388451-107388473 TGCTCCATTTTGTACCTGCTGGG + Intronic
912589572 1:110802559-110802581 GCCTCCTTTTTGGCACTGCATGG - Intergenic
922510888 1:226166386-226166408 GCCTCCTTTTCAAAACTGCTGGG + Intronic
923474063 1:234316463-234316485 GTCTCCTTTTTGTTCCTCCTTGG - Intronic
924446444 1:244136933-244136955 AGCTCCTTTATGTAACTTCTCGG + Intergenic
1063638288 10:7806057-7806079 GATTCCTTTTTCTAAATTCTTGG - Intronic
1063888749 10:10607380-10607402 GACTCCCATTTGTAACTTGTAGG + Intergenic
1064813020 10:19223280-19223302 GACTGCCATTTGGAACTGCTGGG + Intronic
1065176311 10:23079582-23079604 GAATTCTTGTTGAAACTGCTGGG - Intergenic
1066504121 10:36024243-36024265 GACTCCTTGTTGCCTCTGCTTGG + Intergenic
1068177535 10:53480816-53480838 GAATCATTTTTATAATTGCTTGG - Intergenic
1069035448 10:63641980-63642002 GACTCCTTTCTGCTAATGCTTGG + Intergenic
1070922348 10:80196095-80196117 CTCTCCTTTTTCTAACTCCTAGG + Intronic
1071513409 10:86281610-86281632 GCTTCCTTTCTGTAACTGTTGGG - Intronic
1073595628 10:104797038-104797060 GCCACCTTGTTGTAAGTGCTAGG - Intronic
1073686906 10:105764973-105764995 GATTCCTTTTTGTAAATGTGCGG - Intergenic
1080962541 11:37177506-37177528 GACTCCTGTTGATTACTGCTAGG + Intergenic
1081393382 11:42556868-42556890 AACTCCTTTGTGAAAATGCTGGG - Intergenic
1083654093 11:64220662-64220684 GACGCCTTCTGGTACCTGCTTGG - Exonic
1090451838 11:126813100-126813122 GTCTCCTTGTAGTAACTGCAAGG + Intronic
1099910820 12:88830954-88830976 CACTCCTATTTGTCACTGTTTGG - Intergenic
1102830372 12:115992837-115992859 GACTTCTTTTTGGAACAGCTAGG + Intronic
1106150504 13:27096444-27096466 TACTCATTTGTGTAACTGCAGGG - Intronic
1108968530 13:56342300-56342322 GGCTGCTTTTAGTCACTGCTGGG + Intergenic
1109603256 13:64660288-64660310 GACCCCTTTTTCTAAGTGTTTGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1113054589 13:106254413-106254435 GACTCCCATTTGTTACTGCAGGG - Intergenic
1113325791 13:109279936-109279958 GGCTCCTTTTCCTAACTCCTAGG - Intergenic
1115476145 14:33814744-33814766 AACTTCTTTTTGTCACTGATTGG + Intergenic
1121034196 14:90686115-90686137 TACTCCTTTTTATTATTGCTGGG - Intronic
1132402990 15:101525190-101525212 TACTCCCATTTGTAACTGCCAGG + Intronic
1135917350 16:26616940-26616962 GACTCCTTTCTGGGACTGTTGGG + Intergenic
1136401753 16:30023115-30023137 CCCTCCTCTTTGTAAATGCTGGG + Intronic
1136608046 16:31349530-31349552 GACCCCTGGTTGTATCTGCTCGG + Intergenic
1137689498 16:50412110-50412132 GGCTAATTTTTGTAAGTGCTGGG + Intergenic
1139818557 16:69699066-69699088 TACTACTTTTTATACCTGCTGGG - Intronic
1141058092 16:80837342-80837364 GACTCCTTGTTCTGATTGCTGGG + Intergenic
1203125463 16_KI270728v1_random:1574568-1574590 TACTCCTTTTTGTTACTATTAGG - Intergenic
1144183667 17:12775658-12775680 GCCTACTTCTTATAACTGCTAGG - Intergenic
1146948117 17:36887910-36887932 GACACCTATTTGTGACTTCTAGG + Intergenic
1150303832 17:64067664-64067686 GACTCCTTTGTGAATCTGATGGG - Intronic
1150527876 17:65942490-65942512 GAAACCATTTTGCAACTGCTAGG - Intronic
1153309576 18:3665034-3665056 AGTTCCTTTTTGTAACCGCTGGG + Intronic
1156277961 18:35603047-35603069 GCCTCCTTTTTGGCACTGCATGG + Intronic
1157497305 18:48165502-48165524 TAGTCCTTGTTGTAACTGCTGGG + Exonic
1163890021 19:20002507-20002529 CAGTCCCTTTTGTAGCTGCTTGG + Intronic
1164546223 19:29165512-29165534 AACTCTTTTTTGTTACTGTTTGG - Intergenic
926220044 2:10929717-10929739 GATTCCTTTTTGGATTTGCTGGG + Intergenic
927378397 2:22446703-22446725 GACTTCTATTTCTAACTGCATGG + Intergenic
932057225 2:68458188-68458210 GACACATTCTTGTAAGTGCTGGG + Intergenic
933791903 2:85889537-85889559 GGCTCTATTTTGTAACAGCTTGG + Intergenic
934115351 2:88785437-88785459 TACTCCTCTTTGTTACTGTTGGG + Intergenic
934628354 2:95885372-95885394 TACTCCTCTTTGTTACTGTTAGG - Intronic
934630784 2:95919050-95919072 TACTCCTTTTTGTTACTATTAGG - Intronic
934630920 2:95920924-95920946 TACTCCTTTTTGTTACTATTAGG - Intronic
934631299 2:95926557-95926579 TACTCCTCTTTGTTACTGTTGGG - Intronic
934802740 2:97182424-97182446 TACTCCTCTTTGTTACTGTTGGG + Intronic
934803128 2:97188061-97188083 TACTCCTTTTTGTTACTATTAGG + Intronic
934803268 2:97189950-97189972 TACTCCTTTTTGTTACTATTAGG + Intronic
934804103 2:97201174-97201196 TACTCCTCTTTGTTACTACTAGG + Intronic
934805170 2:97216151-97216173 TACTCCTCTTTGTTACTGTTAGG + Intronic
934833074 2:97552485-97552507 TACTCCTTTTTGTTACTATTAGG - Intronic
934833461 2:97558143-97558165 TACTCCTCTTTGTTACTGTTGGG - Intronic
935065693 2:99645530-99645552 CACCCCTTCTTGTCACTGCTGGG + Intronic
937159782 2:119749278-119749300 GACTCTTTTTTTTAAGTCCTGGG + Intergenic
946009028 2:216550002-216550024 AACTCCCTTTTCTAACTTCTGGG + Intronic
1170190173 20:13638125-13638147 CACTGCTTTTTGTAAGTGGTGGG + Intronic
1175232818 20:57484787-57484809 GTATCCTTTTTGTAAGTGGTAGG - Intergenic
1182731530 22:32499200-32499222 GACTCCTGTTTGTGGCTCCTGGG + Intergenic
1184020889 22:41820725-41820747 GACTCATTTTTTCAAATGCTTGG + Intronic
950651257 3:14408693-14408715 GACTCCTTTTTGTTACTTACTGG + Intronic
952560287 3:34584728-34584750 GAAACCTTTTTATAACTACTTGG - Intergenic
953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG + Intronic
953512701 3:43558900-43558922 CACTCCTTTTTGGACCTGCAGGG - Intronic
954830397 3:53416598-53416620 GAATCCATTTTGTAAATGTTAGG + Intergenic
959029747 3:101284673-101284695 TACTTCTTTTAGAAACTGCTAGG - Intronic
959349620 3:105245443-105245465 GACTCCATTTTGAAACTTCTTGG - Intergenic
960231447 3:115232388-115232410 GACTCCTTTCTGTAAATATTAGG - Intergenic
962872259 3:139507702-139507724 GTCCCCTTTTTGTAGCTTCTTGG + Intergenic
963774679 3:149426448-149426470 GACTCCCCTTTGTATCTGATGGG + Intergenic
963919315 3:150890760-150890782 GACTCTTTGTTGTGTCTGCTTGG + Intronic
964562274 3:158010642-158010664 GGCTCCTTTTTGGAATGGCTAGG + Intergenic
970024400 4:11607149-11607171 GACTCATTTTTCTCTCTGCTTGG - Intergenic
971103225 4:23493247-23493269 GAGTCAATTTTATAACTGCTGGG + Intergenic
972329146 4:38047672-38047694 GTCTCTTATTTGTAACTTCTGGG - Intronic
978259112 4:106731518-106731540 CACTCCTCTTTATGACTGCTAGG + Intergenic
983042434 4:162945647-162945669 GAATCCTTTTAATTACTGCTGGG + Intergenic
984339492 4:178437588-178437610 CACTCCTGTCTGTGACTGCTGGG + Intergenic
987873642 5:23651179-23651201 GACTACTTTTTCTAACTTCATGG + Intergenic
989171934 5:38479947-38479969 GAATCCTGATTTTAACTGCTAGG - Exonic
995231256 5:109766628-109766650 AACTCGTTTTTGTAACTGTGGGG + Intronic
1000531054 5:162420328-162420350 GACTCCTTTTTTTGACCTCTAGG + Intergenic
1003135944 6:3434937-3434959 GACTCCTGTTTGGAACTGACAGG - Intronic
1004615949 6:17289104-17289126 TTGTGCTTTTTGTAACTGCTAGG + Intronic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1006563823 6:34936932-34936954 GATTCATCTTTGTATCTGCTAGG - Intronic
1006932872 6:37698023-37698045 GGCTCCTTTTTTTAACTGGAGGG - Intronic
1007554997 6:42758328-42758350 GACTCCTTAGTGTGAATGCTGGG + Intronic
1007630570 6:43270910-43270932 GACTCCTTCCTGTAGGTGCTCGG + Intronic
1008262253 6:49381273-49381295 CATTCCTTTTTGTGACTGCATGG + Intergenic
1010496413 6:76538039-76538061 GGCTCCTTGCTGTAGCTGCTTGG + Intergenic
1011560725 6:88611913-88611935 GACTTCTTTTTTTAAATGCCAGG - Exonic
1013515226 6:110879056-110879078 GAAACCTTTTTGAAACTGCTGGG - Intronic
1014417956 6:121207675-121207697 GTCTACTTTTTGTAAGTCCTGGG - Intronic
1016494484 6:144644782-144644804 GGCTCCATTTTATTACTGCTTGG - Intronic
1017703350 6:157096790-157096812 GACTCCTTTTTAACAGTGCTGGG - Intronic
1021639843 7:22726531-22726553 GACTCCTTTTTGCCACCGCGTGG - Intronic
1023953823 7:44869867-44869889 GATTCATCTTTGTATCTGCTAGG - Intergenic
1027446284 7:78277169-78277191 TACTCATCTTTGTATCTGCTGGG - Intronic
1029790196 7:102835333-102835355 GATTCCTTTCTGTACCTCCTTGG - Intronic
1030334517 7:108310207-108310229 GACTCCTTATGGTTACTACTAGG + Intronic
1034849043 7:154476756-154476778 GTTTTGTTTTTGTAACTGCTGGG - Intronic
1036957679 8:13207306-13207328 GACTCCTTTGGGTTACTGTTAGG + Intronic
1037286693 8:17309084-17309106 GATTCCTTTTGGTAACAGTTGGG - Intronic
1039603654 8:38863517-38863539 GAGTCCTTCTTGCACCTGCTAGG - Intergenic
1041522141 8:58768494-58768516 GTCTCATTTTTGTATCTCCTGGG - Intergenic
1042126980 8:65548164-65548186 GACTACTTTTTCTAAGTGGTGGG - Intergenic
1043203447 8:77404684-77404706 GACTCCTTTTTAAAACTTGTTGG + Intergenic
1047207838 8:122817799-122817821 GACACTTTCCTGTAACTGCTGGG + Intronic
1048416522 8:134232956-134232978 AAGTGCTCTTTGTAACTGCTGGG - Intergenic
1049132685 8:140862145-140862167 GACTCCTTTTTATAATTTCTAGG - Intronic
1057166591 9:92932081-92932103 GAGTTCTTTTTGAAACTTCTTGG + Intergenic
1188872621 X:35392193-35392215 CACAACTTTTTGTAACTGATGGG + Intergenic
1189644459 X:43112187-43112209 GACTCATTCTTCTACCTGCTGGG + Intergenic
1193411026 X:81163119-81163141 GACTTCTTCATGTAGCTGCTTGG - Intronic
1195152525 X:102086534-102086556 GAATCCTCTTTGTAAATGCCTGG + Intergenic
1195910821 X:109887043-109887065 GACAACTTGTTGGAACTGCTTGG + Intergenic
1197089059 X:122515002-122515024 GACTTCTTTTTTTAATTGCTGGG - Intergenic
1197578809 X:128256207-128256229 GGCTCCTTTTAGTCACAGCTGGG + Intergenic
1198747477 X:139904879-139904901 GACTCCTTACTCTACCTGCTAGG - Intronic
1201406595 Y:13656315-13656337 GTCTCCTCTTTGTATCTTCTAGG + Intergenic
1201988734 Y:19999754-19999776 TTATCCTTTTTGTAACTACTGGG - Intergenic