ID: 953436424

View in Genome Browser
Species Human (GRCh38)
Location 3:42881089-42881111
Sequence GGCCCCCGAAGCCTCAGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953436408_953436424 30 Left 953436408 3:42881036-42881058 CCGGGACAGCCAGAGGGCCCGCG 0: 1
1: 0
2: 1
3: 16
4: 144
Right 953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 88
953436416_953436424 13 Left 953436416 3:42881053-42881075 CCCGCGGGCGCTCGGGAAAGGGG 0: 1
1: 0
2: 0
3: 29
4: 104
Right 953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 88
953436411_953436424 21 Left 953436411 3:42881045-42881067 CCAGAGGGCCCGCGGGCGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 88
953436418_953436424 12 Left 953436418 3:42881054-42881076 CCGCGGGCGCTCGGGAAAGGGGC 0: 1
1: 0
2: 0
3: 13
4: 101
Right 953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953436424 Original CRISPR GGCCCCCGAAGCCTCAGCGA GGG Intronic
900152717 1:1185701-1185723 GGCCCCGGAAGCAGCAGCCAGGG + Intronic
902466175 1:16620110-16620132 GGCCCCCATACCCTCAGAGATGG + Intergenic
902478383 1:16699737-16699759 GGCCCACGTAGCATCCGCGACGG + Intergenic
902508515 1:16953193-16953215 GGCCCCCATACCCTCAGAGATGG - Intronic
903679464 1:25087572-25087594 GGCCCCAGAAGCCTCATTGGTGG - Intergenic
906295278 1:44645682-44645704 GGCCCCAGAAGCCTTGGCGGTGG + Intronic
906509664 1:46403682-46403704 GAGCCCCGAAGGCTCAGCCAGGG - Intronic
908193349 1:61725438-61725460 GGACCGAGAAGCCTCAGCTAAGG - Intergenic
921060146 1:211578609-211578631 GGGCCCCGCAGCCGCAGCCATGG - Exonic
1064443006 10:15370737-15370759 GGCCCCCGAAGCCTCCGCCCGGG + Intronic
1067661009 10:48236242-48236264 GGCCCTCCCAGCCTCAGCTAGGG - Intronic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1075096560 10:119475200-119475222 GGGCCCTAAAGCCTCAGTGAGGG - Intergenic
1075174389 10:120145613-120145635 GGCCCCAGAGGCTTCAGGGATGG + Intergenic
1076994679 11:292217-292239 GGCCCCACAAGCCTCAGGGTGGG - Intronic
1077402890 11:2367783-2367805 GGCCCCAGAAGCCTCTGGGGAGG + Intergenic
1077911605 11:6576883-6576905 GGGCTGCGAAGCCTCAGAGAAGG + Intronic
1084216385 11:67648949-67648971 GGCACCTGGAGCCTCAGCAAAGG + Intronic
1085122794 11:73977981-73978003 GGCCCCCGAAGCCTCTACAATGG - Exonic
1088881617 11:113977435-113977457 GGCCCACGGGGCCTAAGCGAGGG - Intronic
1091252120 11:134153031-134153053 GGCCCCCACAGCCTCAGCAGTGG - Exonic
1103613716 12:122139282-122139304 GGTCCTCGAAGCCACAGGGAGGG + Intronic
1108396726 13:49997179-49997201 GGTCCTCGAACCTTCAGCGAGGG + Exonic
1109406230 13:61903515-61903537 TGCCCCCAAAGCCCCAGAGAGGG - Intergenic
1115398258 14:32933376-32933398 GGGCCCCGCAGCCGCAGCCAGGG - Intergenic
1119793867 14:77377918-77377940 GGCCCCCGAAACCTCAGACATGG - Exonic
1121917412 14:97848441-97848463 GGCCTAAGAGGCCTCAGCGACGG + Intergenic
1125004010 15:34797921-34797943 GATCCCCGAAGCCTGTGCGAAGG - Intergenic
1129663728 15:77567563-77567585 GGCCCTCGAATCCTCAGACAGGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131139316 15:89964140-89964162 GCCCGCCGAAGGCTCAGCCAGGG - Intergenic
1132633690 16:932252-932274 GGCCCTCTCATCCTCAGCGATGG + Intronic
1133002813 16:2859696-2859718 GGCTCCCGAAGCCTCCATGAGGG - Intergenic
1137760373 16:50935515-50935537 GTCCCCTGGAGCCTCAGCTAAGG + Intergenic
1142231617 16:88902746-88902768 GGCCCCCGAAGTCTCAGCCACGG - Intronic
1142860067 17:2755864-2755886 GGGCCCCGCAGCCTCAGCCCGGG - Intergenic
1143654667 17:8287025-8287047 AGCCCCCGATGCCTCACTGAAGG - Intergenic
1146594638 17:34157732-34157754 TGCCCCTGGAGCCTCAGAGAAGG + Intronic
1151550990 17:74822369-74822391 GGCCCCGGGAGCCTCAGGGTGGG - Intronic
1152460882 17:80441773-80441795 GGCCCCAGTGGCCCCAGCGAAGG + Intergenic
1152611178 17:81315626-81315648 GGCCCCAGAGGCCTCAGCCTCGG - Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1157287105 18:46384418-46384440 GGCCTCCCAAGCCCCAGCTAGGG - Intronic
1158478705 18:57802794-57802816 AGCCCCCGAGGCCTCGGGGACGG - Intronic
1160044822 18:75376909-75376931 GGCCACCGAACCCTCAGCCCAGG - Intergenic
1160805397 19:990298-990320 GGCCCCCAAAGCCGCAGTGCAGG - Exonic
1160909069 19:1466539-1466561 GGCCGCCCAGGCCCCAGCGAGGG + Exonic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1162935422 19:13979358-13979380 GGCCCCTGAGGCCGCAGGGAGGG - Intronic
1163719980 19:18894319-18894341 GGCCCCCTCAGCCTCTGGGAAGG - Intronic
1163776858 19:19224066-19224088 GGCCTCCTGGGCCTCAGCGAAGG - Exonic
1165120347 19:33554965-33554987 GGCCCCAGGAGCCTCAGCAGAGG + Intergenic
1165411314 19:35663855-35663877 GGCCCACCATGCCTCAGCAAAGG - Intergenic
925994797 2:9283477-9283499 TTCCCCTGAAGCCTCAGGGAAGG - Intronic
932566981 2:72916766-72916788 AGCCCCCAGAGCCTCAGAGAAGG + Intronic
937045186 2:118847272-118847294 GGCAGGCGAAGCCTCAGCGAAGG + Exonic
946353935 2:219173066-219173088 GGCCACCGATGCCACAGCCAGGG + Exonic
947716895 2:232345441-232345463 GGCCCCTGCCACCTCAGCGATGG + Intergenic
948231430 2:236351966-236351988 GGCCTCCGAGGCCACAGCAATGG + Intronic
1174393751 20:50233698-50233720 GGCCCCTGAGGCCTCAAGGAGGG - Intergenic
1175174411 20:57102353-57102375 GGCCTCAGGAGCCCCAGCGATGG - Intergenic
1181566471 22:23741835-23741857 CGCACCCGGAGCCTCAGGGATGG - Exonic
1183361779 22:37386605-37386627 GCCCCCCGTAGCCTCAGAGGCGG - Intronic
1185173760 22:49307655-49307677 GCCCCCAGAAGCCCCAGGGAAGG + Intergenic
949844725 3:8357826-8357848 TGCCCCTGAGGCCTCAGCAATGG - Intergenic
951558710 3:23945552-23945574 GGCCCCGGCCGCCTCCGCGAGGG + Exonic
953406547 3:42662720-42662742 TGCCCCCAAAGCTTCAGGGAAGG - Intronic
953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG + Intronic
953565682 3:44029806-44029828 GGGCCCTGATGCCTCAGAGAAGG + Intergenic
954751616 3:52817270-52817292 GGCCCCTAAATCCTCGGCGACGG + Intronic
961406568 3:126683924-126683946 GGCCACAGAACTCTCAGCGAGGG - Intergenic
974908283 4:68083324-68083346 GGCCCCCTAAGGCACAGGGATGG + Intronic
982650333 4:158080525-158080547 GTCTCCTGAAGCCTCAGGGAAGG - Intergenic
1001565459 5:172696786-172696808 GGCCCCCCCAGCCTCAACGCTGG + Intergenic
1001722852 5:173870693-173870715 GGCCTCCGAGGGATCAGCGATGG - Intergenic
1002056007 5:176598208-176598230 GGCTCCCACAGCCTCAGGGAAGG - Exonic
1002521548 5:179795528-179795550 GACACCCGAAGCCCCAGAGATGG - Intronic
1006752516 6:36387588-36387610 GGCCCCAGCAGCCACAGCCAGGG - Exonic
1006914668 6:37586468-37586490 GGCCCCCGACCCCACTGCGATGG - Intergenic
1006935365 6:37713524-37713546 AGCCTCAGAAGCCTCAGTGATGG - Intergenic
1015221242 6:130806005-130806027 GGCCCCCGAGGGGTCAGAGAAGG + Intergenic
1016329871 6:142945118-142945140 GGCCGCCGCAGCCGCAGCGGTGG + Exonic
1020100251 7:5390425-5390447 GGCCCCAGAAGCCTCTCAGAAGG + Intronic
1031974586 7:128085639-128085661 GGCTCCCAGAGCCTCAGCAATGG - Intronic
1035171112 7:157017990-157018012 GGCCCCCGGAGCCGCAGCCCGGG + Intergenic
1035282968 7:157788773-157788795 GGCCCCAGAAGCCTCCCCTATGG - Intronic
1047220117 8:122911990-122912012 GGCCCCCAGAGCCTTAGCCAGGG - Intronic
1049611687 8:143558837-143558859 GACCCCCAAAGCCTCAGCCTTGG + Intronic
1050330557 9:4541077-4541099 GACCCCCAAAGCCCCAGCAATGG - Intronic
1061028597 9:128066606-128066628 GGCCACCGCAGCCGCAGCCACGG - Exonic
1061252143 9:129432670-129432692 AGGCCCCGAAGACCCAGCGATGG - Intergenic
1062610234 9:137370178-137370200 GGCCCCCAAAGCCTGAGACAGGG - Intronic
1189247225 X:39572517-39572539 GGCCCTGGGAGCCTCAGTGAAGG + Intergenic
1200119605 X:153784084-153784106 GGCGGCCGTAGCCTCAGCGCGGG + Exonic