ID: 953437422

View in Genome Browser
Species Human (GRCh38)
Location 3:42889540-42889562
Sequence GACATGTGCCACTGTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 2, 2: 22, 3: 46, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953437417_953437422 5 Left 953437417 3:42889512-42889534 CCAAGCGCTCCAGGGGCTTTGGG 0: 8
1: 22
2: 26
3: 29
4: 174
Right 953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG 0: 1
1: 2
2: 22
3: 46
4: 249
953437419_953437422 -4 Left 953437419 3:42889521-42889543 CCAGGGGCTTTGGGTTTGTGACA 0: 2
1: 24
2: 32
3: 48
4: 199
Right 953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG 0: 1
1: 2
2: 22
3: 46
4: 249
953437414_953437422 12 Left 953437414 3:42889505-42889527 CCAAACACCAAGCGCTCCAGGGG 0: 11
1: 19
2: 20
3: 20
4: 99
Right 953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG 0: 1
1: 2
2: 22
3: 46
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953437422 Original CRISPR GACATGTGCCACTGTGGAGG AGG Intronic
901222015 1:7588615-7588637 AACATGGGCCACTGTGGCTGGGG - Intronic
901526576 1:9826721-9826743 GAAATGTGCCAATGTGGCTGAGG - Intergenic
902414593 1:16231410-16231432 GTCATGTGGCGCTGTGGGGGAGG - Intergenic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
902928125 1:19710906-19710928 CACATGTGCCAAAGTGGAGGTGG + Intronic
902969980 1:20041269-20041291 CACAGGTGACACTCTGGAGGGGG - Intronic
905179403 1:36156837-36156859 CACATGTGCCACGGGGGATGGGG - Intronic
905637384 1:39563832-39563854 GACAGCTGCCAGTCTGGAGGTGG - Exonic
905831054 1:41067843-41067865 GAAATGTACCACTCTGGTGGAGG + Intronic
907152516 1:52302413-52302435 AATATTTGCCACTGTGGATGTGG - Intronic
907327350 1:53647890-53647912 GGCATGTGCCACTGTGTCTGGGG - Intronic
907449679 1:54536975-54536997 CACATATGCCACTGTGGAGGAGG + Intergenic
907829310 1:58049090-58049112 CACATATGCCACTGTGGAGGAGG - Intronic
908413172 1:63886785-63886807 GATTTGTGCCAGTGTGGAGGTGG - Intronic
909348947 1:74625851-74625873 TACATGAGCCACTGTTCAGGTGG + Intronic
909850186 1:80451806-80451828 CACTTATGCCACTGTGGAGGAGG - Intergenic
910640953 1:89461399-89461421 CACAAGTGCCACTCTAGAGGAGG + Intergenic
911700005 1:100941756-100941778 CACGTATGCCACTGTGGAGGAGG - Intronic
911714788 1:101119394-101119416 GAAATGTGTCACTGTGGTGCTGG - Intergenic
912346948 1:108972507-108972529 TAAATGTACCACTGTGGAAGGGG + Intronic
912404269 1:109423743-109423765 GTGATGTGTTACTGTGGAGGAGG - Intronic
912518052 1:110228177-110228199 TACATGGGCCTGTGTGGAGGAGG - Intronic
912660661 1:111526626-111526648 TAAATGTACCACTGTGGTGGGGG - Intronic
913132826 1:115857620-115857642 CACATATACCACTGTGGAGGAGG - Intergenic
914454492 1:147823291-147823313 GACATGGGGCACTGTACAGGGGG - Intergenic
918951588 1:191146760-191146782 CACAAATGCCACTGTGGAGGAGG - Intergenic
920016256 1:202911994-202912016 CACATATGCCATTGTGGAGGAGG + Intronic
920405081 1:205703137-205703159 TTAATGTGCCACTGTGGAAGGGG - Intergenic
924794324 1:247281668-247281690 GACATGTGCCAAGGTGGTCGGGG + Intergenic
1063650993 10:7936631-7936653 TAAATGTGCCACTCTGGTGGGGG - Intronic
1065324416 10:24538309-24538331 GACATGTGACACTGTTAATGGGG + Intronic
1065818638 10:29505718-29505740 CAAATGTGCCACTCTGGAGGGGG + Intronic
1065935699 10:30518670-30518692 CACATATGCCACTGTGGAGGAGG - Intergenic
1065954282 10:30678678-30678700 CAAATGTGCCACTCTGGAGGGGG - Intergenic
1066196408 10:33104480-33104502 GACATTTTCCAGTGTGGTGGTGG - Intergenic
1066343039 10:34555157-34555179 CAAATGTTCCACTGTGGTGGGGG + Intronic
1070761533 10:79027272-79027294 GTCACGTGCGACTGTGTAGGTGG + Intergenic
1074365023 10:112850818-112850840 GCCCTGTGCAACTGTGCAGGTGG + Intergenic
1077301984 11:1851728-1851750 GCCATGTGCCACTCTGCAAGGGG + Intergenic
1077651179 11:3974037-3974059 CACATATGCCACTGTGGAGGAGG - Intronic
1077804037 11:5571988-5572010 CACATATGCCACTGTGGAGGAGG - Intronic
1081860328 11:46329875-46329897 GACACATGGCACTGAGGAGGTGG - Intergenic
1084215171 11:67643147-67643169 GGCATGTGCCCATGTGGAAGTGG + Intronic
1085001205 11:73037234-73037256 TAAATGTACCACTGTGGTGGGGG - Intronic
1085161804 11:74354621-74354643 CACATATGCCACTGTGGAGGAGG + Intronic
1086229068 11:84546643-84546665 CACATATGCCACTGTGGAGGAGG - Intronic
1087365649 11:97215276-97215298 AACATGTACCACTGTGGTGAGGG + Intergenic
1088397574 11:109385402-109385424 GAAACGTACCACTGTGGTGGGGG - Intergenic
1090921730 11:131212485-131212507 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1091398099 12:166256-166278 GACTTGGGCCACAGTGGGGGAGG - Intronic
1092499174 12:9028889-9028911 CACATATGCCACTATGGAGGAGG - Intergenic
1096826444 12:54281842-54281864 CACATATGCCACTGTGGAGGAGG + Exonic
1096829384 12:54302290-54302312 GATAGGTGCCACTCTGGAGTAGG + Intronic
1097743380 12:63271565-63271587 CACATGTGCCACTGTGGAAGGGG + Intergenic
1098199097 12:68035945-68035967 CACAAATGCCACTGTGGAGGAGG + Intergenic
1099017315 12:77359365-77359387 GAAATGTACCACTCTGGTGGAGG - Intergenic
1099242398 12:80153500-80153522 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1100256004 12:92883953-92883975 CACACATGCCACTGTGGAGGAGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1105498243 13:20949398-20949420 CATCTATGCCACTGTGGAGGAGG - Intergenic
1105638812 13:22241479-22241501 CTCATGTGCCATTGTGGAGAGGG + Intergenic
1107726259 13:43303048-43303070 GACATCTGGCAAAGTGGAGGGGG - Intronic
1108552798 13:51563437-51563459 CAAATGTACCACTGTGGTGGGGG + Intergenic
1108666995 13:52642672-52642694 CACATATGCCACTGTGGAGGAGG + Exonic
1109868764 13:68303134-68303156 CACATATGCCACTGTGGAAGAGG - Intergenic
1110584366 13:77171105-77171127 GACAAGTGCCTCTGAGGAGATGG + Intronic
1110884856 13:80619870-80619892 CACATATGCCACTGTGGTGGAGG - Intergenic
1113705093 13:112425140-112425162 GCCATGTGCCACAGTGGCGTGGG + Intronic
1115093856 14:29611188-29611210 CAAATGTACCACTGTGGTGGGGG + Intronic
1117404327 14:55387216-55387238 GATATGTACCAATTTGGAGGAGG - Intronic
1117740372 14:58812493-58812515 GAAATGAGTCACTCTGGAGGTGG + Intergenic
1117854647 14:60015770-60015792 GACATGTGTTACTGCTGAGGAGG + Intronic
1119740199 14:77009048-77009070 GACAGTTGTCACTTTGGAGGGGG + Intergenic
1120534932 14:85683056-85683078 AAGATGTGCAAGTGTGGAGGAGG + Intergenic
1121555998 14:94837793-94837815 CACATGTGCCACTCTGGAGGTGG - Intergenic
1121714690 14:96065210-96065232 TACAGGTGCCCCTGGGGAGGAGG + Intronic
1123550394 15:21373024-21373046 GACGTGTGGCTCTTTGGAGGCGG + Intergenic
1123937007 15:25198900-25198922 GCCATGCGCCACTGTGGAGATGG - Intergenic
1123939782 15:25211241-25211263 GCCATGTGCCACCGTGGACATGG - Intergenic
1124211514 15:27768772-27768794 GGCGTGTGCCACTGTGAACGGGG - Intronic
1124817649 15:33012298-33012320 CTCATATGCCACCGTGGAGGAGG + Intronic
1125059388 15:35400869-35400891 CTCATATGCCACTGTGGAGGAGG + Intronic
1126986857 15:54321477-54321499 CACATATGCCACTGTGGAGGAGG - Intronic
1127148490 15:56049948-56049970 GCCACGTGCCTCTGTGCAGGAGG - Intergenic
1127641742 15:60922360-60922382 CAAATGTGCCACTCTGGTGGGGG + Intronic
1129335640 15:74850701-74850723 GACTTGTGCCACAGTGGCTGAGG + Intronic
1130893647 15:88153721-88153743 GACATCTGTCTCTGAGGAGGTGG - Intronic
1132313719 15:100876220-100876242 GGCATGTGCCCCTGTGGTGAGGG - Intergenic
1132618753 16:854703-854725 GACATGTGCCCCCTTGCAGGTGG - Exonic
1132864591 16:2087176-2087198 GACAGCTGCCACTGGGGAGATGG - Intronic
1133622529 16:7540092-7540114 GACATGTGCCTCATTGGTGGTGG + Intronic
1135482505 16:22832758-22832780 GCCATGAGCCACAGTGGAAGGGG + Intronic
1136371626 16:29840366-29840388 GCCATCTGCCAAAGTGGAGGTGG + Exonic
1137773467 16:51036800-51036822 GCCCTGTGCCACTGCGGATGTGG + Intergenic
1137841611 16:51645997-51646019 CACATATGCCACTGTGGAGGAGG + Intergenic
1138398412 16:56725839-56725861 GAAATGTACCACTCTGGTGGGGG - Intronic
1138907771 16:61358615-61358637 GAAATGTACCACTGTGCTGGAGG + Intergenic
1139503162 16:67385010-67385032 CTCATGTGCCACTGGTGAGGAGG - Exonic
1141576922 16:84970037-84970059 GGCATGAGCCACTGTGCAGAAGG + Intergenic
1141830361 16:86506918-86506940 CCCATGTGCCTCTGTGTAGGCGG - Intergenic
1142123460 16:88398581-88398603 GACATGTGCCACAGATGAAGGGG + Intergenic
1142795949 17:2306939-2306961 CACATATGCCACTGAGGAGGAGG + Intronic
1143614259 17:8039973-8039995 GAGATGTACCAGTGAGGAGGGGG + Exonic
1145005735 17:19336758-19336780 GTCCTGTGCCACTGGAGAGGTGG + Intergenic
1146650341 17:34602470-34602492 GACAGGGGCCAGGGTGGAGGAGG + Intronic
1147054544 17:37824379-37824401 GACATGTGCCCCTAGGGACGTGG + Intergenic
1148222663 17:45874901-45874923 GAAATGTACCACTCTGGTGGGGG - Intergenic
1148467956 17:47876083-47876105 GACATGTGTCACTGTGGGTCTGG + Intergenic
1148733055 17:49849568-49849590 GACATGTGCCAGCGTAGCGGTGG + Intergenic
1148839904 17:50488288-50488310 GCCAGGTCCCACTATGGAGGAGG - Intergenic
1149606006 17:57925748-57925770 GCCATGTGCAAATGTGAAGGAGG + Intronic
1150246241 17:63677712-63677734 GAAACATGCCACTGTGGATGTGG + Intronic
1152111125 17:78358349-78358371 GCCATGTGCCACGGAGGAGAGGG + Exonic
1152854168 17:82654433-82654455 GCCCTGAGCCACTGTGGAGAGGG - Intergenic
1153330090 18:3864786-3864808 TACATGTGCCACCTTAGAGGTGG - Intronic
1155774136 18:29737642-29737664 CACATGAGCCAATGTGGAAGGGG + Intergenic
1155856008 18:30835442-30835464 AAAATGTACCACTGTGGTGGGGG + Intergenic
1156003539 18:32412975-32412997 CACATATGCCACTGTGGAGGAGG - Intronic
1156404239 18:36769587-36769609 GACGTTGGCCATTGTGGAGGAGG + Intronic
1156473258 18:37390561-37390583 GTCATGTGCTAGGGTGGAGGGGG + Intronic
1157444856 18:47737020-47737042 GACATGTGCCATTTTGAAGCAGG - Intergenic
1158420036 18:57285195-57285217 GACATGTGCATATGTGGGGGTGG - Intergenic
1158800257 18:60898503-60898525 GACATGTGCTAAGGTGCAGGAGG - Intergenic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1160047522 18:75400623-75400645 GACAGCTGTCACTCTGGAGGAGG + Intergenic
1162600773 19:11666829-11666851 CACGTATGCCACTGTGGAGGAGG - Intergenic
1163604354 19:18265956-18265978 GACATTTGCCACTGTTGGAGAGG + Exonic
1163849038 19:19653254-19653276 GACCTGTGTCACTGGGAAGGGGG + Intronic
1164912112 19:32021280-32021302 CACATGTGCCAGGGAGGAGGTGG - Intergenic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
1166286086 19:41829847-41829869 CACATATGCCACTGTGAAGGAGG + Intergenic
925811969 2:7709932-7709954 GACATGTGCCATTCAGCAGGAGG + Intergenic
926104604 2:10142408-10142430 AAGAGGGGCCACTGTGGAGGTGG + Intronic
926396965 2:12453457-12453479 GAAATGTGCCACTGTGTCGGTGG - Intergenic
926414568 2:12636462-12636484 GAGGTGTGCCAGGGTGGAGGAGG - Intergenic
926947663 2:18205761-18205783 GACATGTACCACTATGGTGCAGG - Intronic
928366803 2:30709167-30709189 CACATGTGCCACTCTGGTGTGGG - Intergenic
928674455 2:33636681-33636703 CACATATGCCACTGTGGAGGAGG + Intergenic
929365921 2:41156774-41156796 CACATATGCCACTGTGGAGGAGG + Intergenic
929586953 2:43122252-43122274 GGCATGGGCCAGTGTGTAGGGGG - Intergenic
930241764 2:48942849-48942871 CACATGTGCCACTCTGGTGGGGG - Intergenic
931388677 2:61820377-61820399 CACCTATGCCACTGTGGAGGAGG + Intergenic
931578930 2:63752436-63752458 CACCTATGCCACTATGGAGGAGG - Intronic
931684917 2:64784732-64784754 GACATGGGGCACTGTGCAGCTGG + Intergenic
931965495 2:67529197-67529219 AACATGTACCACTGTGGTGCAGG + Intergenic
935189598 2:100766284-100766306 GTCATGAGCAAATGTGGAGGGGG - Intergenic
935853644 2:107250045-107250067 CAAATGTGCCACTCTGGTGGTGG - Intergenic
936025538 2:109028489-109028511 ACCATGAGCCACTGTGCAGGAGG - Intergenic
937987877 2:127646659-127646681 GTCATAGGCCTCTGTGGAGGTGG - Intronic
939040008 2:137177293-137177315 GTCATGTGTGACTCTGGAGGGGG + Intronic
939639904 2:144627781-144627803 TCCATGTGCCACTGAAGAGGTGG + Intergenic
939897400 2:147808680-147808702 GTCATGTGGCACCCTGGAGGCGG - Intergenic
941764572 2:169282917-169282939 CACCTGTGCCACTGTGAAGAAGG - Exonic
941816675 2:169802793-169802815 GAAATGTACCACTCTGGTGGGGG - Intronic
941855478 2:170226601-170226623 GTCATATGTCAGTGTGGAGGCGG + Intronic
941941214 2:171040363-171040385 CATATGTGCCACTGTGGTGTGGG + Intronic
942274586 2:174310773-174310795 CACATGTGCCACTGTGGAGGAGG - Intergenic
943528918 2:189054006-189054028 GACATTGGTCACTGTGTAGGAGG + Intronic
944456054 2:199895904-199895926 GACATGAGCCACTGTGGCAGCGG - Intergenic
944482689 2:200174277-200174299 CAAATGTGCCACTCTGGTGGGGG - Intergenic
944572992 2:201063268-201063290 CACATATGCCACTGTGAAGGAGG + Intronic
945117249 2:206420036-206420058 CATATATGACACTGTGGAGGAGG - Intergenic
945798500 2:214394685-214394707 CACATGTGCCACTCTGGCAGGGG - Intronic
946309876 2:218877568-218877590 GACATGTGGAACTGGGGAGATGG + Intergenic
946428291 2:219611550-219611572 GAGTTGTGGCACTGTGGGGGGGG + Intronic
946471285 2:219963593-219963615 GTTATAAGCCACTGTGGAGGGGG + Intergenic
947805576 2:232965769-232965791 GACATGTGGCACAGTGGAGCTGG + Intronic
1169336882 20:4763960-4763982 AACTTGTCCCACTGTGGATGAGG - Intergenic
1171095076 20:22325105-22325127 CACAAGTGCCAGTGTGGATGTGG - Intergenic
1171464457 20:25317860-25317882 GACATGGGCCACCTGGGAGGAGG + Intronic
1172604267 20:36204032-36204054 GGCATGTCTCCCTGTGGAGGTGG + Intronic
1173003643 20:39123484-39123506 GACAAGGGCCACAGAGGAGGGGG - Intergenic
1173433915 20:43015965-43015987 GACATGTCGCAATGTGGACGTGG - Intronic
1173905898 20:46628496-46628518 GACAGGTGCCACAGGGAAGGAGG + Intronic
1175191636 20:57215689-57215711 TGCATCTGGCACTGTGGAGGTGG + Intronic
1175961528 20:62639319-62639341 GAAACGTGCCACTCTGGAGCTGG + Intergenic
1176650847 21:9545632-9545654 AACATGTGGCACTGTGGGGAGGG - Intergenic
1179098024 21:38332921-38332943 CACCTGTGTCACTCTGGAGGCGG + Intergenic
1179985442 21:44918345-44918367 GACATTTGCCTCTGTGGATGGGG - Intronic
1180028735 21:45186067-45186089 GACATATGCACGTGTGGAGGTGG - Intronic
1181105831 22:20574611-20574633 GAGGTGTGCCACTGAGAAGGAGG + Intronic
1181386802 22:22552001-22552023 GACATGAGCCACTGTGCTGGAGG - Intronic
1181412461 22:22734019-22734041 CACATGTGCCCGTGTGGATGTGG + Intergenic
1181420088 22:22791933-22791955 CACATGTGCCCGTGTGGATGTGG + Intronic
1181424139 22:22822219-22822241 CACATGTGCCCGTGTGGATGTGG + Intronic
1181691505 22:24564735-24564757 GAGATGTGCCCCTGTGCTGGAGG + Intronic
1183310654 22:37107776-37107798 GACATCTGACCCTTTGGAGGAGG - Intronic
950534006 3:13569121-13569143 GACTTGGGCCAGGGTGGAGGAGG + Intronic
950575176 3:13827957-13827979 GACAGGTGGCTCTGTGGAGGAGG - Intronic
951361615 3:21731451-21731473 CAAATGTACCACTGTGGTGGAGG - Intronic
951905149 3:27698924-27698946 CAAATGTACCACTGTGGTGGGGG + Intergenic
953050253 3:39335156-39335178 GACATATGCCACTGTGGAGGAGG + Intergenic
953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG + Intronic
953650599 3:44799650-44799672 AAAATGTGCCACTGTGGGGCAGG - Intronic
954328769 3:49877947-49877969 GACATGTGGCTCTGGGGAGGGGG - Intergenic
954896551 3:53979842-53979864 GGCATGAGCCACTGTGGACTTGG + Intergenic
957438859 3:80216419-80216441 CACATATGCCACTGTGGAGAAGG + Intergenic
958901813 3:99895971-99895993 GACATGTGGCTCACTGGAGGAGG + Intronic
959771152 3:110098237-110098259 CAAATGTGCCACTCTGGTGGGGG - Intergenic
961370751 3:126428557-126428579 CAAATGTGCTACTCTGGAGGGGG + Intronic
962842884 3:139251783-139251805 GCCTTGTGCCAATGGGGAGGTGG - Intronic
963094523 3:141522283-141522305 GAGATGGACCACTGTGGTGGAGG + Intronic
963664617 3:148167095-148167117 CACCTATGCCACTATGGAGGAGG - Intergenic
963683239 3:148407742-148407764 GATATGTGCCACTTTCGAGCAGG + Intergenic
963924818 3:150939943-150939965 GACATGAGCCAGTGAGGAGAGGG - Intronic
966289977 3:178343849-178343871 GGCATGTACCACAGTGGTGGAGG - Intergenic
967154126 3:186677251-186677273 GACATGGGCAATAGTGGAGGAGG - Exonic
967690751 3:192470902-192470924 GAGGTGTGAAACTGTGGAGGAGG - Intronic
968044420 3:195616051-195616073 CAAATGTGCCACTCTGGTGGGGG - Intergenic
968060209 3:195722102-195722124 CAAATGTGCCACTCTGGTGGGGG - Intronic
968131616 3:196195787-196195809 GGCATGGGCCACGGGGGAGGGGG - Intergenic
969844865 4:9912551-9912573 GGCATGCCCAACTGTGGAGGGGG - Intronic
971227879 4:24771649-24771671 CACCAATGCCACTGTGGAGGAGG + Intergenic
971444113 4:26723997-26724019 GAAAGGTGCCTCTGAGGAGGTGG + Intronic
971952266 4:33367960-33367982 GGCATCTACCACTTTGGAGGAGG + Intergenic
972943224 4:44222440-44222462 TACATATGCAACTGTGGAGAAGG - Intronic
973839092 4:54842753-54842775 GCCACGTGACACTGTGGAGGAGG - Intergenic
975400979 4:73939363-73939385 CACATATGCCACTATGGAGGAGG - Intergenic
975740471 4:77424756-77424778 GAGATGGACCACTGTGGTGGGGG + Intronic
975794177 4:77988612-77988634 CACATATGCCACTGTGGAGGAGG - Intergenic
977987985 4:103407406-103407428 AACATGTGCTACTGTGGTTGGGG + Intergenic
978033012 4:103958987-103959009 CAAATGTACCACTGTGGTGGGGG + Intergenic
978813958 4:112881948-112881970 CACGTATGCCACTGTGGAGGAGG - Intronic
980480115 4:133377055-133377077 TACATGGGCCTATGTGGAGGTGG + Intergenic
980603515 4:135058853-135058875 GACATGTGCCAATGTTAGGGTGG - Intergenic
981235172 4:142406961-142406983 GAGAGGTGCCATTGTGCAGGAGG - Intronic
981509850 4:145544147-145544169 CAAATGTGCCACTCTGGTGGGGG + Intronic
981523063 4:145684643-145684665 CAAATGTACCACTGTGGTGGGGG + Intronic
982198683 4:152938692-152938714 GGCATGTGCCACAGAAGAGGTGG - Intronic
986373941 5:7110951-7110973 CAAATGTGTCACTGTGGTGGGGG + Intergenic
987337910 5:16913535-16913557 TGCATCTGCCACTGTGGAGGTGG + Intronic
988904392 5:35771315-35771337 GAGTTGTGACACTCTGGAGGTGG + Intronic
990208317 5:53453900-53453922 GACAAGTGCCATTGGGGAGGGGG - Intergenic
991149856 5:63355126-63355148 CAAATGTGCCACTCTGGTGGGGG - Intergenic
992808231 5:80359838-80359860 CACATATGCTACTGTGGAGGAGG - Intergenic
995252633 5:110011861-110011883 CCCATGTGCCACTGTCCAGGTGG - Intergenic
996752166 5:126899870-126899892 CACATGTACCACTGTGGTGTGGG - Intronic
997759244 5:136429071-136429093 CACATATGCCACTGCGGAAGAGG + Intergenic
999305531 5:150517139-150517161 GAAAAGTACCACTGTGGTGGGGG - Intronic
999568870 5:152896035-152896057 GACATCTGCCACTGTGAACATGG + Intergenic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1002777479 6:341399-341421 GGTATTTCCCACTGTGGAGGAGG + Intronic
1003037645 6:2658998-2659020 GACATGTGTCATTGGGGAGCTGG + Intergenic
1003072030 6:2952458-2952480 GACATCTTCCACGCTGGAGGTGG + Intronic
1003237247 6:4306597-4306619 CAAATGTGCCACTCTGGTGGAGG - Intergenic
1003307859 6:4945716-4945738 GAGAGGTGCCAGTTTGGAGGTGG - Intronic
1003701534 6:8471246-8471268 AACTTATGCCACTGTGGAAGAGG - Intergenic
1003843157 6:10143538-10143560 CAAATGTGCCACTCTGGTGGGGG + Intronic
1004743981 6:18491677-18491699 GAGCTGAGCCCCTGTGGAGGGGG - Intergenic
1006204160 6:32325397-32325419 CACATATGCCACTGTGGAGGAGG + Intronic
1006764124 6:36489866-36489888 AACATTTGCCACTGAGGAGTTGG + Exonic
1006873144 6:37271465-37271487 CAAATGTACCACTGTGGTGGCGG + Intronic
1007694833 6:43725473-43725495 GCCAGGTGATACTGTGGAGGAGG + Intergenic
1008933672 6:56966604-56966626 GATAAGTGACACTGTGGAGCAGG + Intronic
1009166070 6:60342792-60342814 GATATGTGTCACTGTTGTGGTGG + Intergenic
1011441865 6:87395888-87395910 AACATGTGCCACCGTGGTGCAGG + Intronic
1011669022 6:89664304-89664326 GACTTCTGCCTCAGTGGAGGTGG + Intronic
1013611269 6:111798277-111798299 GACATGTGCCAGTGTGGTTGAGG - Intronic
1015148675 6:130015956-130015978 TACATGTGGCAGGGTGGAGGAGG + Intronic
1015724280 6:136284815-136284837 GGCAAGTGCCACATTGGAGGGGG + Intronic
1016125583 6:140398825-140398847 CACATGTCCCACTCTGGTGGGGG - Intergenic
1016864837 6:148755797-148755819 GACATCTAGCTCTGTGGAGGTGG - Intronic
1016912109 6:149209306-149209328 TACATGTTACACTGTGGATGGGG + Intergenic
1017177140 6:151515560-151515582 GGCGTGAGCCACTGTGCAGGTGG + Intronic
1019485713 7:1288355-1288377 GCCATGAGCCACTGTGATGGTGG + Intergenic
1021703506 7:23343771-23343793 GACATGTGCCAAAGCTGAGGAGG - Exonic
1021859230 7:24889774-24889796 GAAATCTGAAACTGTGGAGGGGG + Intronic
1022306786 7:29154154-29154176 GACAGTTGCCCCTGGGGAGGAGG + Intronic
1022334231 7:29407310-29407332 CAACTGTGCCACTGTGGAGGGGG + Intronic
1022860041 7:34358158-34358180 GAGAAATGCCACAGTGGAGGAGG + Intergenic
1023780168 7:43647827-43647849 GACATGGGCCACTCTCGAGAGGG - Intronic
1024123359 7:46267295-46267317 GATGTGTGGGACTGTGGAGGTGG + Intergenic
1026397184 7:69967350-69967372 GACATGTGCCATTTGTGAGGAGG + Intronic
1026739064 7:72967108-72967130 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026790085 7:73325740-73325762 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1027104669 7:75397965-75397987 GGCCTTGGCCACTGTGGAGGAGG - Intronic
1027334872 7:77139559-77139581 CAAATGTGCCACTCTGGTGGAGG + Intronic
1027514468 7:79124912-79124934 CACAAATGCCACTGTAGAGGAGG + Intronic
1027964106 7:84983735-84983757 CACATATGCCACTGTGGAGGAGG + Intergenic
1028164417 7:87521643-87521665 CACATATGCCACTGTGGAGGAGG + Intronic
1029780923 7:102731552-102731574 CAAATGTGCCACTGTGGTGGAGG - Intergenic
1029846118 7:103413930-103413952 CAGATGTGCCACTCTGGTGGGGG - Intronic
1031294261 7:119982833-119982855 GAAATCAGCCACTGTGGAGCAGG + Intergenic
1031855096 7:126912573-126912595 GACTTGGGCCACTCTGGAAGAGG + Intronic
1032655757 7:133928250-133928272 CACCTGTGCCATTGTGGTGGTGG + Intronic
1032708218 7:134440558-134440580 GACATTTGCCCCTGTGAAGTTGG - Intergenic
1035230894 7:157464890-157464912 GACCTCTGCCACTGGGGAGCTGG - Intergenic
1035412250 7:158654236-158654258 GTCATGTGCTCCTGTGGATGGGG - Intronic
1037021838 8:13982451-13982473 GAATTGTACCACTGTGGTGGGGG + Intergenic
1039925132 8:41923171-41923193 CAAATGTACCACTGTGGAGGAGG + Intergenic
1043261983 8:78212513-78212535 GAGATGAGTCAATGTGGAGGGGG + Intergenic
1043589166 8:81807951-81807973 CACATATGCCACTGTGGGGGAGG + Intronic
1046829626 8:118730307-118730329 AACATGGGGCACAGTGGAGGAGG - Intergenic
1050373378 9:4945703-4945725 CATGTGTGCCACTGTGGAGGAGG - Intergenic
1054865392 9:69995106-69995128 GACAAGTGACACTGTGGTGTGGG + Intergenic
1056645854 9:88411261-88411283 CACATATGCCACTGTGGAGGTGG - Intronic
1057026746 9:91739903-91739925 GACATGTCCCTGTCTGGAGGCGG + Intronic
1057851817 9:98571950-98571972 CACATGGGGCACTGGGGAGGAGG - Intronic
1057933632 9:99218233-99218255 CACACGTGCAGCTGTGGAGGAGG + Exonic
1059119453 9:111628786-111628808 GACATGATCCAATGTGGAGATGG + Intergenic
1060475911 9:123986454-123986476 GACATGAGACAGTGTGGAGAAGG - Intergenic
1060684444 9:125595846-125595868 CACCTATGCCACTGTGGAGGAGG + Intronic
1061825198 9:133254007-133254029 GCTTTGTGCCACTGTGGAGCAGG - Intronic
1061826016 9:133258613-133258635 GCTTTGTGCCACTGTGGAGCAGG - Intronic
1061926721 9:133809577-133809599 GACATGTGCAATGGTGGATGTGG - Intronic
1062668636 9:137693572-137693594 GTCCTGTGCCACTGTGTGGGGGG - Intronic
1062668805 9:137694216-137694238 GTCCTGTGCCACTGTGTGGGGGG - Intronic
1062668846 9:137694384-137694406 GTCCTGTGCCACTGTGTGGGGGG - Intronic
1202629176 M:2540-2562 AACATGTGTCACTGGGCAGGCGG - Intergenic
1203628581 Un_KI270750v1:49182-49204 AACATGTGGCACTGTGGGGAGGG - Intergenic
1185916560 X:4041946-4041968 GACAAGTGCCAGTGATGAGGTGG + Intergenic
1185957526 X:4507794-4507816 CAAATGTGCCACTCTGGTGGGGG - Intergenic
1195023893 X:100856179-100856201 CACATACGCCACTGTGGAGGAGG - Intronic
1195027093 X:100888390-100888412 TACATACGCCACTGTGGAGGAGG - Intergenic
1196763367 X:119220961-119220983 CACATATGCCACTGTGGAGGAGG + Intergenic
1199845716 X:151691735-151691757 GAAATGTGCCACTGAGAAGATGG - Intergenic
1201362510 Y:13168360-13168382 GAAATGAGTCAGTGTGGAGGAGG - Intergenic
1201614042 Y:15876049-15876071 AACATGTGCTATTCTGGAGGTGG + Intergenic
1201616326 Y:15903731-15903753 AACATGTGCTATTCTGGAGGTGG - Intergenic
1201633103 Y:16092082-16092104 GCCATGTGCCACCATGGAGATGG + Intergenic