ID: 953439213

View in Genome Browser
Species Human (GRCh38)
Location 3:42903859-42903881
Sequence TTGAATATACAAATGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 4, 2: 27, 3: 121, 4: 567}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953439206_953439213 0 Left 953439206 3:42903836-42903858 CCTACCTTATTCACCCCGAGACA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG 0: 1
1: 4
2: 27
3: 121
4: 567
953439204_953439213 29 Left 953439204 3:42903807-42903829 CCTGTGGACTTGAATTCCATGTT 0: 1
1: 0
2: 1
3: 10
4: 181
Right 953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG 0: 1
1: 4
2: 27
3: 121
4: 567
953439205_953439213 13 Left 953439205 3:42903823-42903845 CCATGTTTATCTTCCTACCTTAT 0: 1
1: 0
2: 3
3: 32
4: 367
Right 953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG 0: 1
1: 4
2: 27
3: 121
4: 567
953439207_953439213 -4 Left 953439207 3:42903840-42903862 CCTTATTCACCCCGAGACATTGA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG 0: 1
1: 4
2: 27
3: 121
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953439213 Original CRISPR TTGAATATACAAATGGGCAA TGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904990276 1:34586988-34587010 GGGAATATACTAATGAGCAAAGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906363772 1:45187760-45187782 TCCAATTTAAAAATGGGCAAAGG + Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
908505927 1:64800082-64800104 TCCAATTTAAAAATGGGCAAAGG - Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
909840711 1:80319470-80319492 TTGAATATATAAATGCTCTAAGG - Intergenic
909981652 1:82109400-82109422 TTGAATAAACTAAAGGGCATGGG - Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
911258670 1:95661855-95661877 TACAATTTAAAAATGGGCAAAGG - Intergenic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
912424089 1:109571050-109571072 TTTAATATACAGATTGGCACTGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
914948937 1:152093136-152093158 TCCAATTTAAAAATGGGCAAAGG - Intergenic
915017496 1:152748151-152748173 TACAATTTAAAAATGGGCAATGG - Intronic
915077704 1:153324060-153324082 TCAAATAGAAAAATGGGCAAAGG + Intergenic
915351433 1:155229037-155229059 TGGAATGTGCAAATGGGTAATGG + Intergenic
915354216 1:155246217-155246239 TGGAATGTGCAAATGGGTAATGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917381347 1:174412285-174412307 TGGAAAACATAAATGGGCAAGGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917943206 1:179944063-179944085 TTTAATATACTAGTGGGGAATGG - Intergenic
918123423 1:181559453-181559475 TTGAAAATAAAAGTGGGGAAAGG + Intronic
918554851 1:185786436-185786458 ATGAAAATACATATAGGCAAAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919203187 1:194385968-194385990 TAGATTATAAAAATTGGCAATGG - Intergenic
919523391 1:198617373-198617395 TAGGATATCCAAATGGCCAATGG + Intergenic
920595605 1:207266676-207266698 TTCAATTTAAAAATGGGCAAAGG + Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922722780 1:227907015-227907037 GTGAAAAGACAAATGGGCATGGG - Intergenic
922742841 1:228024487-228024509 TCCAATTTAAAAATGGGCAAAGG - Intronic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923907715 1:238403872-238403894 TTGAATATATAAATTGGAAAGGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924604070 1:245517062-245517084 ATGAATATAAAAATGGGGATGGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
924841813 1:247718941-247718963 TCTAATTTAAAAATGGGCAAAGG + Intergenic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063483468 10:6397394-6397416 TTCAATTTAAAAATAGGCAAAGG - Intergenic
1063796201 10:9516568-9516590 TTGTGTATAGAAATGGGCATTGG - Intergenic
1064117465 10:12591167-12591189 TTGATTATTCTAGTGGGCAATGG + Intronic
1064367669 10:14722644-14722666 ATCAATTTAAAAATGGGCAAAGG - Intronic
1064608410 10:17069843-17069865 TTGATTTTTAAAATGGGCAAAGG - Intronic
1065088430 10:22204127-22204149 TTGAATAGACAAAAGAGAAATGG - Intergenic
1065259116 10:23906375-23906397 TGGAATATCCAAATGTGAAATGG + Intronic
1065508608 10:26455183-26455205 TTAAATATAAATATGGGCCATGG + Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066538586 10:36419348-36419370 TTGAATATACACATAGCCTATGG + Intergenic
1066645582 10:37604957-37604979 TTGAATATACACATAGCCTATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067051025 10:43021106-43021128 TCCAATTTAGAAATGGGCAAAGG + Intergenic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068958248 10:62840758-62840780 TAAAACAAACAAATGGGCAAAGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069221909 10:65894094-65894116 TTAAATATATCATTGGGCAATGG + Intergenic
1069274860 10:66577152-66577174 TTGCATTTAAAAGTGGGCAAAGG - Intronic
1069649377 10:70033639-70033661 TTTAATTTACAAATGTGAAAAGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071005081 10:80874999-80875021 TATAATAAAAAAATGGGCAAAGG - Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071253809 10:83848477-83848499 TTGATTTTAAAAATGGGCAAAGG + Intergenic
1071339260 10:84628107-84628129 TCCAATAAACAAATGAGCAAAGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071377095 10:85017968-85017990 TTCAATTAAGAAATGGGCAAGGG - Intergenic
1071421918 10:85509034-85509056 GTGAATAGACAAATGAGCATGGG + Intergenic
1072370292 10:94759268-94759290 TTGATTAAAAAAATGGGCAACGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1072627820 10:97124896-97124918 TGGAATAGAGAAATAGGCAAAGG + Intronic
1072976053 10:100059428-100059450 TTGATTTTTTAAATGGGCAAAGG + Intronic
1073316682 10:102586224-102586246 TTCAATTTAAAAATGAGCAAAGG - Intronic
1073372386 10:103002285-103002307 TCCAATTTAAAAATGGGCAAAGG + Intronic
1073500838 10:103935486-103935508 TTGGACATAGGAATGGGCAAAGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075905373 10:126076681-126076703 TTCAATTTAAAAATGGGCAAAGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1078481848 11:11683616-11683638 TAAATAATACAAATGGGCAAAGG + Intergenic
1078838607 11:15056317-15056339 TTGAATATAGACAAGGGGAAAGG + Intronic
1078952564 11:16151090-16151112 TATAACATACAAATGGGAAATGG + Intronic
1079043902 11:17082858-17082880 TCCAATTTAAAAATGGGCAAAGG - Intronic
1079291295 11:19190417-19190439 TTCAATATACAAATGATCAGTGG - Intronic
1080308428 11:30862077-30862099 TGGAATAAACAAATGGGCCATGG + Intronic
1080325865 11:31072266-31072288 TTCAATACAAAAATGGGCAAAGG - Intronic
1080340316 11:31255650-31255672 TTCAATTAAAAAATGGGCAAAGG - Intronic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1080999643 11:37652795-37652817 TTGATTTAAAAAATGGGCAAAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081376551 11:42366275-42366297 TTGATTTAAAAAATGGGCAAAGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083034836 11:59627367-59627389 TCCAATTTAAAAATGGGCAAAGG - Intergenic
1085239268 11:75038840-75038862 TTCAATTTTTAAATGGGCAAAGG - Intergenic
1085758111 11:79218295-79218317 TTGGCTACAAAAATGGGCAAGGG + Intronic
1085973095 11:81617604-81617626 TACAATTTAAAAATGGGCAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086941003 11:92798541-92798563 ATGAAAATGGAAATGGGCAATGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088583266 11:111335331-111335353 GTGAAGTTACAAAGGGGCAAAGG + Intergenic
1088949064 11:114546970-114546992 TTGAATAAACAAATATGTAAGGG + Intronic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1090960687 11:131553871-131553893 GTGAAAATATATATGGGCAACGG - Intronic
1091752054 12:3028931-3028953 TTTATTATAAAAATGGGCAATGG - Intronic
1092214739 12:6673092-6673114 TTGAGGCTACCAATGGGCAAAGG + Intronic
1092516015 12:9213654-9213676 TTGAATTAAAAGATGGGCAAAGG - Intergenic
1093171748 12:15868906-15868928 TTAAACATACAAATAGGCGAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093956595 12:25227498-25227520 TTCAATTTAAAAATGGGCAAAGG + Intronic
1094296140 12:28907715-28907737 TTTAATTTTAAAATGGGCAAAGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096812140 12:54177915-54177937 TTCAACATACAAATCGGCAGGGG - Intronic
1097311515 12:58124037-58124059 ATGACTTTAAAAATGGGCAATGG + Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098352513 12:69578851-69578873 TTTCATATACAATTTGGCAATGG - Exonic
1099045805 12:77717898-77717920 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1099232794 12:80047340-80047362 TCCAATTTAAAAATGGGCAAGGG + Intergenic
1099968581 12:89477083-89477105 TTCATTATACAAATAGGAAATGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100342700 12:93695906-93695928 ATAAATAAATAAATGGGCAAAGG + Intronic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1101520386 12:105476974-105476996 TCTAATTTAAAAATGGGCAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104599947 12:130146034-130146056 TTGGATGGACAAATTGGCAAGGG - Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106205302 13:27587619-27587641 TTTAATCTACAAAGGGGTAAGGG + Intronic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106506178 13:30372376-30372398 TTGAAGATAAAAACAGGCAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106928482 13:34637769-34637791 GGGAATATATAAATGTGCAACGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107068355 13:36242363-36242385 TGGGATATCCAAATGGCCAAAGG - Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107743655 13:43481828-43481850 TATAATTTAAAAATGGGCAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108135884 13:47358954-47358976 TCAAATTTAAAAATGGGCAAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108535462 13:51371977-51371999 TTGAAAATAAAAATGAGAAAAGG - Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110138494 13:72098896-72098918 TTTAATGAAAAAATGGGCAAAGG + Intergenic
1110469790 13:75846458-75846480 TGGAAAATACAAATAGGGAAAGG - Intronic
1110589165 13:77234459-77234481 TTAAATGTACAAGTGGGTAAAGG + Intronic
1110654656 13:77983463-77983485 TTCAATAAAGAAATGTGCAAAGG - Intergenic
1111597761 13:90433166-90433188 TTGAAAAAACAAATGGGAGAGGG - Intergenic
1111868294 13:93797528-93797550 ATGAATATATGAATGAGCAAGGG + Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112978554 13:105352323-105352345 TTGTATTTACAAATAGGCAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114127118 14:19741426-19741448 TCTAATTTAAAAATGGGCAAAGG + Intronic
1114307288 14:21435511-21435533 TTTATTATAGAAATGGGCAAGGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115142030 14:30182730-30182752 TTAAATATGCAAAAGGGCAGGGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115223070 14:31076485-31076507 TGCAATGTAAAAATGGGCAAAGG - Intronic
1115695421 14:35892820-35892842 TTTCATTTAAAAATGGGCAAAGG - Intronic
1115887023 14:37983630-37983652 TGGATTTTAAAAATGGGCAAAGG + Intronic
1116066224 14:39986495-39986517 TTTAATGTATAATTGGGCAATGG - Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1117257685 14:53996251-53996273 TTCAATAAAAAAATGAGCAAAGG + Intergenic
1117861848 14:60100193-60100215 TTCAATAGAAAAATAGGCAAAGG + Intronic
1117949784 14:61070873-61070895 TTAAATTTTAAAATGGGCAAAGG - Intronic
1118429925 14:65707325-65707347 TCCAATTTAAAAATGGGCAAAGG - Intronic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119629809 14:76219270-76219292 TCCAGTATAAAAATGGGCAAAGG + Intronic
1120297933 14:82667895-82667917 TTGAAAAGAAAAATGGGGAAAGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120921186 14:89756723-89756745 TAAAATTTAAAAATGGGCAAAGG + Intergenic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1123570577 15:21603062-21603084 TCTAATTTAAAAATGGGCAAAGG + Intergenic
1123606691 15:22038416-22038438 TCTAATTTAAAAATGGGCAAAGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125174054 15:36799629-36799651 TTGAATAAACAAAATGCCAAAGG - Intronic
1125525983 15:40374945-40374967 TTGATAATACACATGGGTAATGG + Intergenic
1126042655 15:44607649-44607671 TTGAAATGAGAAATGGGCAAAGG + Intronic
1126973165 15:54141972-54141994 TTGTTTATATAAATGAGCAATGG - Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128365122 15:66994246-66994268 TTGAAAACATAAATGGGCAAAGG + Intergenic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1128864834 15:71106608-71106630 TTGTAAATACAACTTGGCAATGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131230758 15:90657416-90657438 TCCAATATATAAATGGTCAATGG + Intergenic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132217668 15:100078882-100078904 TCCAATTTAAAAATGGGCAAAGG + Intronic
1132324299 15:100954321-100954343 TTGATTTTTAAAATGGGCAAAGG - Intronic
1202978930 15_KI270727v1_random:330186-330208 TCTAATTTAAAAATGGGCAAAGG + Intergenic
1135171106 16:20184442-20184464 ATGGACATACAAATGTGCAAAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135872844 16:26166931-26166953 TTTGATAGAAAAATGGGCAAAGG - Intergenic
1135995279 16:27243419-27243441 TTGAACATACAAACAGCCAATGG + Intronic
1137354351 16:47745321-47745343 TTGAATAAACTAATGGCCATAGG + Intergenic
1139330341 16:66183674-66183696 TTGAAAATACAACTGGGGAGGGG - Intergenic
1139831707 16:69804029-69804051 TTCAATATAAAAATGAGCAAAGG - Intronic
1140138877 16:72234865-72234887 TTCAATTTTTAAATGGGCAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1145084683 17:19927494-19927516 TCTAATTTAAAAATGGGCAAAGG + Intronic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1146145842 17:30415580-30415602 TCTAATTTAAAAATGGGCAAAGG + Intronic
1146250570 17:31339370-31339392 TTAAATATAAAAATGGGATAAGG - Intronic
1147128870 17:38394070-38394092 TTCAATAAACAAAGGGGCTATGG - Intronic
1147549692 17:41431308-41431330 TTTAATTTAAAAATGGGCTAAGG + Intergenic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1149805172 17:59610394-59610416 TATAATAGAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1150903744 17:69314736-69314758 TTGAATTGAGGAATGGGCAAGGG + Intronic
1151861222 17:76763574-76763596 TCCAATTTAAAAATGGGCAAAGG - Intronic
1152084383 17:78208818-78208840 TTTAATTTATAAATTGGCAAAGG + Intergenic
1152582915 17:81176101-81176123 TTCAATTCAAAAATGGGCAAAGG + Intergenic
1152910070 17:82998798-82998820 TTCAACACAAAAATGGGCAAAGG + Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153323372 18:3794460-3794482 TTGACTATAGCAATGGGGAATGG + Intronic
1153732897 18:8033194-8033216 TATAATATAAAACTGGGCAAAGG + Intronic
1153748576 18:8206612-8206634 TTTAATAGAAAAATAGGCAAAGG + Intronic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1154397925 18:14008943-14008965 ATGAATAAATAAGTGGGCAAAGG - Intergenic
1154968001 18:21378843-21378865 ATTAATTTAAAAATGGGCAATGG - Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155884052 18:31186054-31186076 TAGAATATAAAACTGGGTAAGGG + Intergenic
1156510964 18:37636348-37636370 TAGAATATTCAAATGAGCGATGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157018533 18:43749906-43749928 TTAGATAGAAAAATGGGCAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157240139 18:46001417-46001439 TTGGTTAAAAAAATGGGCAACGG - Intronic
1157628303 18:49070562-49070584 TAGAGAACACAAATGGGCAAAGG - Intronic
1158098076 18:53797786-53797808 TTGAATAAGTAAAGGGGCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158294995 18:55986369-55986391 TCCAATTTAAAAATGGGCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159432403 18:68370242-68370264 TAGAATTTAGAAATGAGCAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1166210398 19:41303149-41303171 TGTGATATGCAAATGGGCAAAGG - Intronic
1168081025 19:54010545-54010567 TTGAAAATAAAAAGGGGAAATGG - Intronic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
927108076 2:19844731-19844753 TAGATTATAGAAATGAGCAAGGG - Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927271530 2:21215303-21215325 TAGAATATACAAAAAGGAAATGG - Intergenic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929678634 2:43965685-43965707 TTCAATTAACAAATGGGCAAAGG + Intronic
929717318 2:44326165-44326187 TTACAAATACAAATGAGCAATGG + Intronic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930617941 2:53613575-53613597 TAAAACATACAAATGGCCAATGG - Intronic
930893628 2:56420915-56420937 TTCCATTTAAAAATGGGCAAAGG - Intergenic
931297348 2:60941017-60941039 TTTAATATAGAGATGGGAAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933621882 2:84552503-84552525 TTAAGTAAAAAAATGGGCAAAGG - Intronic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935582043 2:104764523-104764545 TTTAAAATGCAAATGAGCAATGG + Intergenic
935664937 2:105502970-105502992 ATGAAAATACAAATGGGGTAGGG - Intergenic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937177963 2:119961244-119961266 TGCAATTTAAAAATGGGCAATGG + Intronic
937614012 2:123898107-123898129 TTCAATTAAAAAATGGGCAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938134813 2:128747835-128747857 TTTAAAAGAAAAATGGGCAAAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939097133 2:137845912-137845934 TCGATTTTAAAAATGGGCAAAGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939797583 2:146665831-146665853 TTCAATTAAGAAATGGGCAAAGG + Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940186879 2:150995594-150995616 TCCAATTTAAAAATGGGCAAAGG + Intergenic
940194313 2:151076425-151076447 TTAAAAAAAGAAATGGGCAAAGG + Intergenic
940764658 2:157776866-157776888 TTTCAAATACACATGGGCAATGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944458932 2:199924102-199924124 GTGTAAATACAAAAGGGCAAAGG + Intronic
944840108 2:203616486-203616508 TTAGAGGTACAAATGGGCAAGGG + Intergenic
944888657 2:204092646-204092668 TTCAATTAAAAAATGGGCAATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
946135487 2:217643443-217643465 TTTAATATACTAATGTGCATAGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169609023 20:7358382-7358404 TTCAAAATAAAAATGTGCAATGG + Intergenic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170190094 20:13637066-13637088 TTCAATTTAAAAATGGGCAAAGG + Intronic
1170757744 20:19219373-19219395 TTGAATGAACAAATGGGTGAAGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170927138 20:20735250-20735272 TCTAATAGAAAAATGGGCAAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172101847 20:32488933-32488955 TCAAATAGAGAAATGGGCAAAGG - Intronic
1172212936 20:33213695-33213717 TTGAGTATAAAAATGTGGAAGGG - Intergenic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173788348 20:45811582-45811604 AGGAAACTACAAATGGGCAAAGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174119551 20:48252465-48252487 TTGAATAGATAAAGGGGCAGGGG - Intergenic
1174533775 20:51235629-51235651 TTTAATATACAAAGGGGACAAGG + Intergenic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175417579 20:58811882-58811904 TTTATTTTACAAATGGGCACTGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175969424 20:62676467-62676489 TCCAATTTAAAAATGGGCAAAGG + Intronic
1175984414 20:62756913-62756935 TCCAATTCACAAATGGGCAAAGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177425378 21:20916127-20916149 TTGAAAATAACAATGGGGAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178096887 21:29224720-29224742 TCCAATTTAGAAATGGGCAAAGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178945372 21:36942758-36942780 TCCAATTTAAAAATGGGCAAAGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179212390 21:39336090-39336112 TTGAAAATCTAAATGGGCACTGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182156710 22:28080507-28080529 TCCAATTTAAAAATGGGCAAAGG - Intronic
1182425806 22:30271468-30271490 TCCAATTTAAAAATGGGCAAAGG + Intergenic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1183155069 22:36068539-36068561 ATCAATTTAAAAATGGGCAAAGG + Intergenic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
952914083 3:38218489-38218511 TCCAATTTAAAAATGGGCAAAGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953275046 3:41486807-41486829 TTGTGTATACAAATGGTCAATGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953560107 3:43982201-43982223 TTGATTTTAAAAATAGGCAAAGG - Intergenic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
953592515 3:44272860-44272882 TCCAATTTAAAAATGGGCAACGG - Intronic
953725055 3:45390287-45390309 ATAAAAATAAAAATGGGCAAAGG - Intronic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
954281500 3:49582296-49582318 TTGAAAACAAAAATAGGCAAAGG - Intronic
954470671 3:50691884-50691906 TTGACTTTTAAAATGGGCAAAGG - Intronic
954842047 3:53520440-53520462 TTCAATTTAAAAATGAGCAAAGG - Intronic
954998900 3:54908344-54908366 TTTAATTTAAATATGGGCAAAGG - Intronic
955460516 3:59177769-59177791 TCAAATTTAAAAATGGGCAAAGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961366650 3:126404060-126404082 TTCAGTAGAGAAATGGGCAAAGG + Intronic
961398791 3:126618887-126618909 TTTGATTTAAAAATGGGCAAAGG + Intronic
962131444 3:132682038-132682060 TGAATTATACAAAAGGGCAATGG - Exonic
962209066 3:133461194-133461216 TTGAAGATACAAATGAGGACTGG - Intronic
962408326 3:135119183-135119205 TTAAATATAGAAAAAGGCAAGGG - Intronic
962570378 3:136707355-136707377 TCCAATTTACAAATGGGCAAAGG + Intronic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965207056 3:165734168-165734190 TTTAAAAAACAAATGGGAAAAGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968198869 3:196734786-196734808 TTGAATATATGAATTGGCAAAGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970619900 4:17807312-17807334 TTCAATAAAGAAATGAGCAATGG + Intronic
970778577 4:19707667-19707689 TCCAATTTAAAAATGGGCAAAGG + Intergenic
970994171 4:22246906-22246928 TTGATTAAACAAATGGGTGATGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972000353 4:34024061-34024083 TTGAGTAAATAAAGGGGCAAAGG - Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972698879 4:41474492-41474514 ATAAAAATAAAAATGGGCAAAGG + Intronic
973585468 4:52385935-52385957 TCCAATTTAAAAATGGGCAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973917011 4:55644306-55644328 TCCAATTTAAAAATGGGCAAAGG - Intergenic
974148255 4:57972721-57972743 TTGAATATACACATGGGCTGTGG + Intergenic
974497835 4:62656273-62656295 TTGAATAAAGAAATTGGCAAAGG - Intergenic
974777008 4:66497464-66497486 TTAATTATACATGTGGGCAAGGG - Intergenic
975408598 4:74021868-74021890 TTGAAAATACAACTTAGCAATGG + Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
975583350 4:75926701-75926723 TCCAATTTAAAAATGGGCAAAGG + Intronic
976714182 4:88105862-88105884 TTCAATTTTAAAATGGGCAAAGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
976894527 4:90092513-90092535 TGCAATTTAAAAATGGGCAAAGG - Intergenic
977177384 4:93834082-93834104 TTGAACTTTCAAATGGGCAAAGG - Intergenic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979064889 4:116118125-116118147 ATAAAAATAAAAATGGGCAAAGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
980162386 4:129181584-129181606 ATAAAAATAAAAATGGGCAAGGG - Intergenic
980162781 4:129185784-129185806 TCTAATTTAAAAATGGGCAAGGG - Intergenic
980174709 4:129330544-129330566 TTGAAGATACAAAGTTGCAAGGG + Intergenic
980209861 4:129773172-129773194 TTGAATATACAAGTTGGGGACGG - Intergenic
980320052 4:131259906-131259928 ATAAATATATAAATGTGCAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981349016 4:143707506-143707528 TTCAATGAAAAAATGGGCAAAGG - Intergenic
981350506 4:143723923-143723945 TCCAATAGAAAAATGGGCAAAGG + Intergenic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982273680 4:153617914-153617936 TTCAAAAGAAAAATGGGCAAAGG - Intronic
982798245 4:159671045-159671067 TTGAATATACAAAGTTGCAGAGG - Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
984420434 4:179514364-179514386 TTCAATATACGAATGAGGAAAGG - Intergenic
984433372 4:179677396-179677418 TTGTAAATACAACTGAGCAATGG + Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
984967868 4:185156255-185156277 TTAAAAAAAAAAATGGGCAAAGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987105911 5:14639090-14639112 TTGAAAAAAAAAATGGGCAAAGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
987866896 5:23553475-23553497 TTCATTAAAAAAATGGGCAAAGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988978590 5:36540933-36540955 GAAGATATACAAATGGGCAACGG - Intergenic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
991156959 5:63449256-63449278 TTGAATATCAAAATGGGACAGGG - Intergenic
992168572 5:74078807-74078829 TTGAAGAAAAAAATGGGAAAAGG - Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
993208492 5:84918240-84918262 TTCAATTAAAAAATGGGCAAAGG + Intergenic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
994012901 5:94928173-94928195 ATGAATTTACCAATGGGTAAAGG - Intronic
994031110 5:95144231-95144253 TTCAATTAAAAAATGGGCAAAGG - Intronic
994361559 5:98855598-98855620 TAGAATGTAAAAATGGGGAAAGG - Exonic
994653090 5:102554297-102554319 TAGAATATATCAATAGGCAAGGG - Intergenic
995030609 5:107476413-107476435 TTGAAAATACAGATGTGTAAAGG - Intronic
995209742 5:109523792-109523814 TTCAAGATCCAAATGAGCAAAGG + Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996150775 5:120031954-120031976 TTGACTATACGAAGGGGCATTGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997707395 5:135969974-135969996 TTGTATATACAATTGTGCATTGG + Intergenic
998544824 5:143018166-143018188 TGAAATAGAAAAATGGGCAAAGG - Intronic
998694064 5:144617417-144617439 TTCAGTTTATAAATGGGCAAGGG + Intergenic
998873547 5:146576245-146576267 TTGTTTATGCAAATGGGCATAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999852547 5:155558451-155558473 TTCAATTTAAGAATGGGCAAAGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1001876138 5:175202806-175202828 TTGAACATAAAAAGGAGCAATGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002958956 6:1896453-1896475 TAGAGTGGACAAATGGGCAAAGG + Intronic
1004011159 6:11689058-11689080 GTGAATATACAAAGTAGCAAAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004628158 6:17395972-17395994 TCCAATTTAAAAATGGGCAAAGG + Intronic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008774629 6:55022730-55022752 TTCAATTAAAAAATGGGCAAAGG + Intergenic
1008836518 6:55838465-55838487 TTTAATAAAAAAATAGGCAAAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008883435 6:56405684-56405706 TTGAATAAATAAATAGGGAAGGG + Intergenic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009227220 6:61030759-61030781 TTTAATATACAAAGGGGAAGAGG - Intergenic
1009319143 6:62264499-62264521 TTGAATCTACAAAAGAGCATGGG + Intronic
1009700465 6:67171405-67171427 TCCAATTCACAAATGGGCAAAGG + Intergenic
1009866665 6:69406558-69406580 TTGTATGTACCTATGGGCAAAGG - Intergenic
1009871468 6:69457824-69457846 TCTAACATAAAAATGGGCAAAGG - Intergenic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1009906653 6:69877715-69877737 TGGATTAAAAAAATGGGCAAAGG + Intronic
1010412331 6:75574663-75574685 TAGAATATAGACATGGGCAAAGG + Intergenic
1010773224 6:79856797-79856819 TTCAATATACAAATGCGGAGGGG + Intergenic
1011212803 6:84972299-84972321 TTCAAAATAAAAGTGGGCAAGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012860466 6:104553077-104553099 TCCAATTTAAAAATGGGCAATGG + Intergenic
1013432743 6:110069604-110069626 TAGACTATAGAAAAGGGCAAGGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013897563 6:115108509-115108531 TTCAATATATAAATGGGCCAAGG + Intergenic
1014758933 6:125333701-125333723 TCCAATTTACAAATGGGCAAAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015741451 6:136459067-136459089 TCAAATTTAGAAATGGGCAAAGG + Intronic
1016061281 6:139633745-139633767 TTGCATAAACAAACAGGCAAAGG + Intergenic
1016398616 6:143654028-143654050 TCCAATGTTCAAATGGGCAAAGG + Intronic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016601064 6:145861262-145861284 TTTGATTTAAAAATGGGCAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017966103 6:159267847-159267869 GTGAATCCACAAATTGGCAATGG - Exonic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018190333 6:161304673-161304695 TTCAACATACAAATTTGCAAGGG + Intergenic
1018691431 6:166347196-166347218 TTGCATCAACCAATGGGCAAAGG - Intergenic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1020434568 7:8148810-8148832 TTGAAGATATAAAGGGGCTAAGG + Intronic
1020577504 7:9952307-9952329 TTTAATTTTAAAATGGGCAAAGG - Intergenic
1020875318 7:13685946-13685968 TTCCATATAAAAATAGGCAAAGG - Intergenic
1020883764 7:13797144-13797166 TTGACAATAAGAATGGGCAAAGG + Intergenic
1021271318 7:18590007-18590029 TTGAACATACAAACAGGAAAAGG - Intronic
1022851787 7:34270782-34270804 TTTAATATGCAAATGGGCTGGGG + Intergenic
1023037153 7:36142026-36142048 TTTAATTTACTAATGTGCAAGGG - Intergenic
1023229465 7:38010468-38010490 TCCAATTTAAAAATGGGCAAAGG - Intronic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023578475 7:41655480-41655502 TTGATAATATACATGGGCAAAGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024320034 7:48056285-48056307 TCCAATTTAAAAATGGGCAAAGG - Intronic
1024582906 7:50814609-50814631 TTCAATATTTAAATGGGGAAGGG - Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027409790 7:77904290-77904312 TTGACTAAACAAAAGGGAAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030068845 7:105681123-105681145 TCTAATTTAAAAATGGGCAAAGG + Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031053882 7:116972979-116973001 GTGAATAAACAAATGGGTGAGGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1031794543 7:126155538-126155560 GTGAATATACAAATGAGTTAAGG + Intergenic
1032575790 7:133052843-133052865 ACGAATATACAAATGAGCTATGG - Intronic
1032909361 7:136412210-136412232 TTACATATTCAAAAGGGCAAAGG - Intergenic
1033092377 7:138397711-138397733 TCAAATTTAAAAATGGGCAAAGG + Intergenic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034712829 7:153209792-153209814 TTCAATTCAAAAATGGGCAAAGG - Intergenic
1034828069 7:154285070-154285092 TTGAATATAGATGTTGGCAATGG + Intronic
1034846291 7:154449245-154449267 TTCAATTTAAAAATAGGCAAAGG + Intronic
1035793266 8:2327239-2327261 TTCAATATACTCATGTGCAACGG + Intergenic
1035799538 8:2394466-2394488 TTCAATATACTCATGTGCAACGG - Intergenic
1037367769 8:18141151-18141173 TTGAATATAAAAATGTTCTAGGG - Intergenic
1038064457 8:23949206-23949228 TGGAATATAAAAATGGTCAGTGG + Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038852461 8:31293196-31293218 ATAAATTTAAAAATGGGCAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040767845 8:50937208-50937230 TTTAAAAAAAAAATGGGCAATGG + Intergenic
1040810383 8:51445884-51445906 TTGAAAATACAATTGTGGAAAGG - Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041206388 8:55502553-55502575 TTCAATTTAGAAATGGGCAAAGG - Intronic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041527641 8:58824853-58824875 ATGAATATACAAATGGGGGGTGG + Intronic
1041562114 8:59229982-59230004 ATGCATTAACAAATGGGCAAAGG + Intergenic
1042095186 8:65207638-65207660 TAAGATATACAAATGGCCAACGG - Intergenic
1042474925 8:69236804-69236826 TTCAAAAGAAAAATGGGCAATGG - Intergenic
1042689109 8:71477385-71477407 TTCAATTTTAAAATGGGCAATGG + Intronic
1042952266 8:74213360-74213382 TCGATTTTAAAAATGGGCAAAGG - Intergenic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043505954 8:80902903-80902925 TTCAATTTAAAGATGGGCAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044465316 8:92496580-92496602 TTGACTAATCAAATTGGCAAAGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1045674475 8:104591676-104591698 TGTAATATATAAATTGGCAAAGG + Intronic
1045822330 8:106354095-106354117 TTAAAAAAAAAAATGGGCAAAGG - Intronic
1046644244 8:116767351-116767373 TTGAATAAACAAATGTGCTTGGG - Intronic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047686506 8:127310107-127310129 TCCAATATATAAATGGGCAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049976367 9:863868-863890 ATCAATAGAGAAATGGGCAAAGG - Intronic
1050414614 9:5402929-5402951 TTGAAAACAGAAATGAGCAAGGG + Intronic
1050945143 9:11508190-11508212 TTCAATTTTAAAATGGGCAAAGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051208099 9:14711276-14711298 TCCAATTTAAAAATGGGCAAAGG + Intergenic
1052255393 9:26449929-26449951 GTCAATTTAAAAATGGGCAAAGG + Intergenic
1053183456 9:35993961-35993983 TTGAATTTGTAAATGGCCAAGGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055242789 9:74204254-74204276 TGAAATATACATCTGGGCAATGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056344426 9:85676414-85676436 GAAAATATATAAATGGGCAATGG + Intronic
1056749957 9:89342102-89342124 TCCAATTTAAAAATGGGCAAAGG + Intronic
1056856824 9:90138714-90138736 TTGTAAATAGAAATGGTCAAGGG + Intergenic
1057830123 9:98399870-98399892 TTCAAAATAAAAATGGTCAAAGG + Intronic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1058712915 9:107696707-107696729 TTAAATTTACAAACGGGTAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1061220860 9:129250842-129250864 TCCAATTTAAAAATGGGCAAAGG + Intergenic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062059914 9:134489755-134489777 TTGTGTATACAAGTCGGCAATGG - Intergenic
1186155773 X:6724959-6724981 TTAAATAAACAAACTGGCAATGG + Intergenic
1186729266 X:12391211-12391233 TTGAAGATTGAAATGGGGAAGGG + Intronic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187819015 X:23265344-23265366 TGGAACAGAAAAATGGGCAAAGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188839879 X:35003214-35003236 ATGAATATACTCATTGGCAATGG + Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1188905892 X:35791358-35791380 TTGAATATACAAATTTTCTATGG - Intergenic
1189538854 X:41965268-41965290 TTAAATTTAAAAATGGGCAAAGG + Intergenic
1189679402 X:43499640-43499662 TCCAATAGAAAAATGGGCAAAGG - Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1190052864 X:47164308-47164330 TCCAATTTAAAAATGGGCAAAGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190724912 X:53182668-53182690 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192001173 X:67153140-67153162 TTCAATCAATAAATGGGCAAAGG - Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193088141 X:77465839-77465861 TAAATTATAAAAATGGGCAAAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1195408828 X:104547029-104547051 TTAAACTTACAAAGGGGCAAGGG + Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1195587578 X:106583161-106583183 TTTAATTAAAAAATGGGCAAAGG + Intergenic
1195880498 X:109587882-109587904 TTAAATGTAAAAATGGGCATAGG + Intergenic
1196080499 X:111625258-111625280 TCCAATCTAAAAATGGGCAAAGG - Intergenic
1197444294 X:126530156-126530178 ATCCATATAAAAATGGGCAAAGG + Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197579115 X:128259661-128259683 ATAAAAATAAAAATGGGCAAAGG + Intergenic
1197903700 X:131400519-131400541 TTGAATTTACAAATCTGTAAGGG + Intergenic
1198263454 X:134987526-134987548 TTTAATATAGAAATGAGCAAAGG + Intergenic
1198608446 X:138370840-138370862 TTTAAAAAAAAAATGGGCAAAGG - Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199414783 X:147568749-147568771 TCCAATTTAAAAATGGGCAAAGG - Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199701811 X:150384436-150384458 TCCAATATAAAAATGGGCAAAGG - Intronic
1199734049 X:150667573-150667595 TTTAAGAGAAAAATGGGCAAAGG + Intronic
1199747213 X:150780081-150780103 TTCAATCTAAAAATGGGCAAAGG + Intronic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201549152 Y:15201072-15201094 TTAAATAAACAAACTGGCAATGG + Intergenic