ID: 953445051

View in Genome Browser
Species Human (GRCh38)
Location 3:42956315-42956337
Sequence CTGTGTACTCAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 914
Summary {0: 1, 1: 0, 2: 6, 3: 115, 4: 792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953445049_953445051 -4 Left 953445049 3:42956296-42956318 CCTCTGGAGGGGAGAAATGCTGT 0: 1
1: 31
2: 58
3: 159
4: 421
Right 953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG 0: 1
1: 0
2: 6
3: 115
4: 792
953445045_953445051 11 Left 953445045 3:42956281-42956303 CCTTGAACGCTGCATCCTCTGGA 0: 1
1: 13
2: 46
3: 73
4: 220
Right 953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG 0: 1
1: 0
2: 6
3: 115
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953445051 Original CRISPR CTGTGTACTCAGAAAGTGGA AGG Intronic
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
900877574 1:5355644-5355666 ATGTGTCCTCACATAGTGGAAGG - Intergenic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902895574 1:19477516-19477538 TTTTGTGCTCAGAAACTGGAAGG - Intronic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905195002 1:36269155-36269177 CTGTGTGTTCAGAAATTGGAGGG - Intronic
905270180 1:36782450-36782472 CTGAGTGCTCAGAAAGAGAAGGG + Intergenic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
906697851 1:47836793-47836815 CTGTGTCCTCATATGGTGGAAGG - Intronic
906892039 1:49727701-49727723 CTGCTTTCTCAGAAAGTAGAGGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
907746135 1:57215488-57215510 CTGTGTGCTCAGAAAGTTTCTGG - Intronic
907810600 1:57865983-57866005 CTGTGTCCTCACATGGTGGAGGG + Intronic
908211507 1:61905251-61905273 CTGTGTCCTCACATAGTGGAAGG + Intronic
908262024 1:62346444-62346466 ATGTGTCCTCAAACAGTGGAAGG - Intergenic
908267361 1:62392585-62392607 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
908554632 1:65245552-65245574 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905684 1:69006194-69006216 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905853 1:69007932-69007954 CTGTGTCCTCACATGGTGGAAGG + Intergenic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
909552002 1:76908325-76908347 CTATGTCCTCACATAGTGGAAGG + Intronic
909870199 1:80729340-80729362 CTGTGTTCTCACATAGTGGAAGG + Intergenic
910271072 1:85395304-85395326 CTGTGTGGTCAGAAAGATGAGGG + Intronic
910454166 1:87378022-87378044 CTGTGTTCTCAGAATGTGTTTGG + Intergenic
910498462 1:87860674-87860696 GTAGGTACTCAGAAATTGGAGGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910676039 1:89817945-89817967 CTGTGTCTTCATATAGTGGAAGG - Intronic
910984210 1:92989831-92989853 CTGTGTCCTCACATAGAGGAAGG + Intergenic
911154575 1:94625525-94625547 CTGTGTCCTCACAGAGTGGGAGG + Intergenic
911168149 1:94743482-94743504 CTGTGTCCTCACATAGTAGAAGG - Intergenic
911228533 1:95334434-95334456 CTGTGTTCTCATATGGTGGAAGG + Intergenic
911255483 1:95628313-95628335 CTGTGTCCTCACATAGTGAAAGG - Intergenic
911709995 1:101060766-101060788 CTGTGTCCTTACATAGTGGAAGG + Intergenic
911723977 1:101221987-101222009 TTGTGTCCTCAGAAAGAGTAAGG + Intergenic
912269708 1:108196721-108196743 CTGTGTCCTCACATGGTGGAAGG + Intronic
912286604 1:108376341-108376363 CTGTGTTCTGAGAAACTGAACGG + Intronic
912293557 1:108450824-108450846 CTGTGTTCTGAGAAACTGAACGG + Intronic
912454802 1:109790171-109790193 TCATGTACTCAAAAAGTGGAGGG - Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912720889 1:112019014-112019036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
912908726 1:113734833-113734855 CTGTGTCCTCACATGGTGGAAGG - Intronic
913056103 1:115161241-115161263 CTGTGTCCTCATATGGTGGAAGG + Intergenic
913162921 1:116161668-116161690 CTGTGTCCTCACATGGTGGAAGG - Intergenic
913940244 1:125096586-125096608 CTATGTCCTCACATAGTGGAAGG - Intergenic
914172399 1:145237606-145237628 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914297277 1:146340072-146340094 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914527044 1:148478609-148478631 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914639354 1:149588526-149588548 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915083894 1:153371326-153371348 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647524 1:157284360-157284382 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647530 1:157284390-157284412 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915663096 1:157419946-157419968 CTGTGTACTCACATAGCAGAAGG - Intergenic
915663137 1:157420189-157420211 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915815992 1:158965536-158965558 CTGTGTTCTGAGAAGGTGGTTGG - Intronic
916489997 1:165293747-165293769 CTGTGTCTTCATAGAGTGGAAGG + Intronic
917224028 1:172762714-172762736 CTATGTCCTCAGAAAGTGGGAGG + Intergenic
917276124 1:173333616-173333638 CTGTGTCCTCAGGAGTTGGAGGG - Intergenic
917685953 1:177416268-177416290 CTGTGTCCTCACATGGTGGAAGG - Intergenic
917758283 1:178126022-178126044 CTGAGTACCCAGAAAGTGTCTGG - Intronic
917846117 1:179021933-179021955 CTGTGGATTCTGAAAGTGGTGGG - Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920844399 1:209581830-209581852 CTGTGTCCCCATATAGTGGAAGG + Intergenic
921887093 1:220317982-220318004 CTGTGTCCTCACATGGTGGAAGG + Intergenic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
922824636 1:228509128-228509150 CTGTGTCCTCACATGGTGGAAGG - Intergenic
922885711 1:229019007-229019029 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923091650 1:230745589-230745611 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923394972 1:233552790-233552812 CTGTGTCCTCACATGGTGGAAGG - Intergenic
923503853 1:234589120-234589142 GTGTCTGCTCAGACAGTGGATGG + Intergenic
923899717 1:238312394-238312416 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923965004 1:239127630-239127652 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
924209637 1:241751341-241751363 CTGTTTGCCCAGAAACTGGAAGG + Intronic
924330461 1:242935971-242935993 CTGTGTCCTCACATGGTGGAAGG - Intergenic
924562740 1:245170654-245170676 CTGTGTCCTCACGTAGTGGAAGG + Intronic
924634134 1:245768738-245768760 CTGTGTCCTTACACAGTGGAAGG - Intronic
1063010192 10:2014073-2014095 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1063168786 10:3487269-3487291 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1063286468 10:4694070-4694092 CTGTGTCCTCACATAGTGCAGGG - Intergenic
1064286506 10:13996101-13996123 CTGTGTCCTCACATGGTGGAAGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1064856461 10:19773757-19773779 CTGTGTCCTCATATGGTGGAAGG + Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065008546 10:21401738-21401760 CTGTGTCCTCACATAGGGGAAGG + Intergenic
1065641365 10:27785986-27786008 CTGAGACCTCAGAATGTGGAGGG + Intergenic
1065737370 10:28766358-28766380 CTTTGTCCTCACATAGTGGAAGG + Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066184727 10:32998156-32998178 CTGTGTCCTCACATGGTGGAAGG + Intronic
1066779909 10:38933219-38933241 CTATGTCCTCACATAGTGGAAGG + Intergenic
1066950108 10:42109249-42109271 CTATGTCCTCACATAGTGGAAGG - Intergenic
1066951306 10:42120417-42120439 CTATGTCCTCACATAGTGGAAGG - Intergenic
1067280765 10:44870477-44870499 CTGTGTCCTCATACAGTAGAAGG + Intergenic
1067427768 10:46222526-46222548 CTGTGTTCTCCCACAGTGGAAGG + Intergenic
1067657089 10:48202708-48202730 GTGTGTACTGACAAAGTGTATGG - Intronic
1067838563 10:49657257-49657279 CTGTGTCCTCACATAGTGGAAGG + Intronic
1068385074 10:56316299-56316321 CTGTGTCCTCACATAGTAGAAGG + Intergenic
1068510387 10:57958224-57958246 CTGTGTCCTCAAAAGGTGGAAGG - Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069376176 10:67795210-67795232 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1070532476 10:77349250-77349272 CTGTGTCCTCACATGGTGGAAGG - Intronic
1070578920 10:77704075-77704097 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1071200577 10:83217631-83217653 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1071398858 10:85249859-85249881 CTGTGTCCTCACACAGTGGAAGG + Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1071860234 10:89664834-89664856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071884130 10:89931007-89931029 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1072000431 10:91190166-91190188 CTGTGACCTCACATAGTGGAAGG + Intronic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1072499321 10:95996997-95997019 CTGTGTCTTCACATAGTGGAAGG - Intronic
1072555407 10:96511036-96511058 CTGTGGACTCAGAATGCAGAGGG - Intronic
1072708667 10:97700965-97700987 CTGTGTCCTCGCACAGTGGAAGG + Intergenic
1074480446 10:113815503-113815525 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1074625433 10:115178720-115178742 CTGTGTCCTCACATGGTGGAAGG - Intronic
1074895680 10:117775716-117775738 CTTTGTACTGAGAAAGTTAAAGG + Intergenic
1074983267 10:118636424-118636446 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1075825853 10:125356583-125356605 CGATGAACTCAGCAAGTGGACGG - Intergenic
1075981690 10:126745874-126745896 TTCTGGACACAGAAAGTGGATGG - Intergenic
1076497441 10:130906155-130906177 CTCTGGACTCAGCAGGTGGAAGG - Intergenic
1076753504 10:132555511-132555533 GTGTGTGCTCACAAAGTGCACGG + Intronic
1077138086 11:1011499-1011521 CTGTGTGGTCAGGAAGTGAAGGG + Exonic
1077977506 11:7263310-7263332 CTGTGTCCTCACATGGTGGAAGG + Intronic
1077980386 11:7294079-7294101 CTGTGTCCTCATATGGTGGAAGG + Intronic
1078340958 11:10497614-10497636 CTGTGTGCCCAGAAAGTGACTGG + Intronic
1078499017 11:11850884-11850906 CTGTGTCCTCACATGGTGGAAGG + Intronic
1079403726 11:20127254-20127276 CTGTGTCCTCACACAGTGGAAGG - Intergenic
1079461107 11:20678708-20678730 CTGTGTCCTCAAATGGTGGAAGG + Intronic
1079551271 11:21701459-21701481 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1079991631 11:27252669-27252691 CTGTGTCCTCACACAGTAGAGGG - Intergenic
1080195487 11:29603631-29603653 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080294090 11:30705274-30705296 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1080492698 11:32783579-32783601 CTGTGTCCTCACATGGTGGAAGG + Intronic
1081062670 11:38500018-38500040 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1082681902 11:56184133-56184155 CTGTGTCTTCATATAGTGGAAGG + Intergenic
1082874778 11:57977325-57977347 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1085250242 11:75138681-75138703 CTGTGTCCTCACATGGTGGAAGG + Intronic
1085923939 11:80991842-80991864 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1086591484 11:88520407-88520429 CTGAGTATTCAGAAAGTGTAAGG - Intronic
1086790429 11:91030733-91030755 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1087477721 11:98657977-98657999 CTGTGTATTCACATGGTGGATGG - Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1087947812 11:104185453-104185475 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1088427737 11:109723441-109723463 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1088705925 11:112464741-112464763 CTTTGGACTCAGAAACTGGTGGG - Intergenic
1089998437 11:122931000-122931022 CTGTGTCCTCACACAATGGAGGG + Intronic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1090255431 11:125280528-125280550 CAGTCTACTCAGAAAGAGAATGG + Intronic
1090302936 11:125662277-125662299 CTGTGTCCCCACATAGTGGAAGG + Intronic
1090405201 11:126472401-126472423 CTGTGTCCTCACAATGTGGAAGG + Intronic
1090860822 11:130650963-130650985 CTGTGGACTCAGAATTAGGATGG + Intergenic
1090961885 11:131564407-131564429 CTGTGTGCTCACATAGTAGAGGG + Intronic
1091009702 11:131988108-131988130 CTGTGTCCTCACATAGTGGAAGG + Intronic
1091022087 11:132109362-132109384 CTGTGTCCTCACATGGTGGAAGG - Intronic
1091637163 12:2205871-2205893 CTGTGTCCTCATATAGTGGAAGG + Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092123364 12:6059595-6059617 CTGTGTCCTCACATGGTGGAAGG + Intronic
1092130523 12:6109518-6109540 CTCTCTAATCAGAAAGTGGTTGG + Intronic
1092350707 12:7753512-7753534 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1093051817 12:14512838-14512860 CTGTGACCTCACATAGTGGAAGG - Intronic
1093207584 12:16269015-16269037 CTGTGTCTTCACATAGTGGAAGG - Intronic
1093909291 12:24727297-24727319 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1094395086 12:29996859-29996881 CTTTGCACTCTGGAAGTGGAGGG + Intergenic
1094542455 12:31373764-31373786 CTGTGCACTCACATGGTGGAAGG - Intergenic
1096005313 12:48165786-48165808 CTGTGTCCTCATATGGTGGAAGG - Intronic
1096924665 12:55130261-55130283 CTGTGTACTCAGTTGGTGGCTGG + Exonic
1097905908 12:64919569-64919591 CTGTGTGCTCACACGGTGGAAGG + Intergenic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1098469533 12:70827474-70827496 CTGGGTCCTCACACAGTGGAGGG + Intronic
1098492264 12:71095344-71095366 CTGTGTCCTCACATGGTGGAAGG + Intronic
1098718338 12:73861062-73861084 CTTTGTTCTCACATAGTGGAAGG - Intergenic
1098766575 12:74497738-74497760 CTGTGTCCTTACACAGTGGAAGG - Intergenic
1099384002 12:81992000-81992022 GTGTATTCACAGAAAGTGGATGG + Intergenic
1099854910 12:88151688-88151710 GGATGTACTCAGAAAGTAGAAGG - Intronic
1100116795 12:91315546-91315568 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1100134049 12:91533161-91533183 CTGTGTCCTCATAGGGTGGAAGG - Intergenic
1100318669 12:93468918-93468940 CTGAGTATTCATTAAGTGGAAGG + Intronic
1101385017 12:104249217-104249239 CTGTGTCCTCACATGGTGGAAGG + Intronic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1102414325 12:112747311-112747333 CTGTGTCCTCACATGGTGGAAGG - Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103966451 12:124642964-124642986 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104128778 12:125872799-125872821 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104236363 12:126941752-126941774 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1105668693 13:22588620-22588642 CTGAGGGCTCAGGAAGTGGAAGG + Intergenic
1106221454 13:27749209-27749231 CTGTGCAGCCAGAAAGCGGAAGG + Intergenic
1106223504 13:27767455-27767477 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1106738913 13:32618028-32618050 CTGTGTTCTCATATGGTGGAAGG + Intronic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1107400823 13:40067311-40067333 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107600127 13:42004617-42004639 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107677137 13:42809070-42809092 CTGTGTCCTCACATAGTGAAAGG - Intergenic
1107791180 13:44003861-44003883 CTGCGTCCTCACATAGTGGAAGG - Intergenic
1108334729 13:49427883-49427905 CTGTATCCTCACATAGTGGAAGG + Intronic
1108432431 13:50367669-50367691 CTGTGTCCTCACATAGGGGAAGG + Intronic
1109233523 13:59787908-59787930 CTGTGTCCTCACATTGTGGAAGG - Intronic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109478094 13:62911506-62911528 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1109504421 13:63281247-63281269 CTGTGTAATCAGAAAATACATGG - Intergenic
1110486447 13:76050453-76050475 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1111260563 13:85734377-85734399 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1111608994 13:90578985-90579007 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1111720301 13:91935423-91935445 CTGTGTCCTCACATGGTGGAAGG - Intronic
1112033035 13:95474631-95474653 CTGTGTATTCAGAAACAGCAGGG + Intronic
1112523745 13:100122874-100122896 CTGTGTCCTCACATGGTGGAAGG + Intronic
1112764259 13:102724001-102724023 CTGTGTGCTCACACGGTGGAAGG - Intergenic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113523388 13:110955860-110955882 TTGAGTACCCAGAAAGTGGACGG + Intergenic
1113701916 13:112394636-112394658 TTGAGTACCCAGAAAGTGGACGG - Intronic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1115126313 14:29998710-29998732 GAGTGTAGTCAGCAAGTGGAGGG + Intronic
1115345667 14:32340823-32340845 CTGTGTGCTCACATAATGGAAGG + Intronic
1115863649 14:37717972-37717994 CTGTGTCCTCACATGGTGGAAGG - Intronic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1116054065 14:39840740-39840762 CTGTGCCCTCACATAGTGGAAGG - Intergenic
1116095072 14:40357268-40357290 CTGTGTCCTCACATAATGGAAGG + Intergenic
1116528820 14:45941042-45941064 CTGTGTATTCACATGGTGGAAGG + Intergenic
1117157701 14:52957184-52957206 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1117180399 14:53185496-53185518 CTGTGTACTCACATAGTGGAAGG + Intergenic
1118386714 14:65261785-65261807 CTGTGTCCTCACATTGTGGAAGG + Intergenic
1118979441 14:70704361-70704383 CTGCGTCCTCACATAGTGGATGG - Intergenic
1119547653 14:75484122-75484144 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1119911468 14:78353432-78353454 CTGTGTCCTCACATGGTGGAAGG + Intronic
1120671463 14:87367058-87367080 CTGTGTCCTCACAAGGTAGAAGG + Intergenic
1120855214 14:89205999-89206021 CTGTGTCCTCCCATAGTGGAGGG - Intronic
1121069919 14:91009279-91009301 CTGTGTCCTCACATGGTGGAAGG - Intronic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121713632 14:96057259-96057281 CTGTGTCCTCACAAAGTGCAAGG - Intronic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1122495843 14:102154365-102154387 CTGTGTCCTCACATGGTGGAGGG + Intronic
1202937349 14_KI270725v1_random:103014-103036 CTATGTCCTCACATAGTGGAAGG - Intergenic
1123395871 15:19934872-19934894 CTATGTCCTCACATAGTGGAAGG + Intergenic
1124149986 15:27168691-27168713 CTGTGTCCCCACACAGTGGAAGG - Intronic
1124245041 15:28061615-28061637 CTGTGTACTCACCTGGTGGAAGG - Intronic
1124395954 15:29301833-29301855 CTGTGTCCTCACATGGTGGAAGG - Intronic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1125298262 15:38226055-38226077 CTGTGTCCTCACATAGTAGAAGG - Intergenic
1125370042 15:38965596-38965618 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1125477395 15:40056205-40056227 CTGTGTACTCAGACTGTGCTTGG + Intergenic
1126182709 15:45801525-45801547 ATGTGTACTCAAAAATTGGGAGG - Intergenic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1126626108 15:50686945-50686967 CTGGGTTCCCAGAAAGTGGTGGG + Intergenic
1127093824 15:55493109-55493131 CTGTGTCCTCACATGGTGGAAGG - Intronic
1128405470 15:67333051-67333073 CTGTGTCCTCACATGGTGGAGGG + Intronic
1128507687 15:68287772-68287794 CTGTGTCCTCACATGGTGGAAGG + Intronic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1130050113 15:80477343-80477365 CTGTGTCCTCACATGGTGGAAGG + Intronic
1130359715 15:83171726-83171748 CTGTGGACTCCAAAAGGGGATGG + Intronic
1130948593 15:88567890-88567912 CTGTATCCTCAGCAAGTGAAAGG - Intergenic
1130949810 15:88576897-88576919 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1131252361 15:90838879-90838901 GGGTGTACTCACAAAGTGGGGGG - Intergenic
1132001273 15:98182276-98182298 CTGTGTCTTCAGATAGTGGAAGG - Intergenic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1132221316 15:100107688-100107710 CTGTGTCCTCGCATAGTGGAAGG - Intronic
1133837623 16:9380796-9380818 CTGTGTCCTCACATAGTAGAAGG + Intergenic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1134600360 16:15528893-15528915 CTGTGTCCTCACACAGTGAAAGG - Intronic
1135030382 16:19033429-19033451 CCTTGTACTCAGAAAGTGCTAGG - Intronic
1135507962 16:23055445-23055467 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136698324 16:32107013-32107035 CTATGTCCTCACATAGTGGAAGG + Intergenic
1136769279 16:32820819-32820841 CTATGTCCTCACATAGTGGAAGG - Intergenic
1136798827 16:33050310-33050332 CTATGTCCTCACATAGTGGAAGG + Intergenic
1136938341 16:34497425-34497447 CTATGTCCTCACATAGTGGAAGG - Intergenic
1136946185 16:34654192-34654214 CTATGTCCTCACATAGTGGAAGG + Intergenic
1136949033 16:34692751-34692773 CTATGTCCTCACATAGTGGAAGG + Intergenic
1136961478 16:34851132-34851154 CTATGTCCTCACATAGTGGAAGG + Intergenic
1137088924 16:36164037-36164059 CTATGTCCTCACATAGTGGAAGG + Intergenic
1137218591 16:46425294-46425316 CTATGTCCTCACATAGTGGAAGG - Intergenic
1137219688 16:46435994-46436016 CTATGTCCTCACATAGTGGAAGG - Intergenic
1137423419 16:48355359-48355381 CTGTGTCCTCATATGGTGGAAGG - Exonic
1137475807 16:48809609-48809631 ATGTGTTCTCACACAGTGGAAGG + Intergenic
1138215770 16:55204010-55204032 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138694348 16:58797860-58797882 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1138730001 16:59184098-59184120 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1139314526 16:66056928-66056950 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1140144953 16:72297660-72297682 CTGTGTCTTCACATAGTGGAAGG - Intergenic
1140590645 16:76348199-76348221 TTTTGTACTGAGAAACTGGAAGG + Intronic
1140694027 16:77514076-77514098 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1140889217 16:79270866-79270888 CTTTGTACTCACAAATTAGAGGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1203071695 16_KI270728v1_random:1082926-1082948 CTATGTCCTCACATAGTGGAAGG - Intergenic
1143113274 17:4565617-4565639 CTATGGGCACAGAAAGTGGATGG - Intergenic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1143570915 17:7757838-7757860 CTCTGTCCTCACATAGTGGAAGG + Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1144147932 17:12416182-12416204 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1144263950 17:13550282-13550304 CTGTGTTCTCAGGAAGAAGAGGG - Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145692486 17:26757281-26757303 CTATGTCCTCACATAGTGGAAGG + Intergenic
1145709219 17:26953909-26953931 CTATGTCCTCACATAGTGGAAGG + Intergenic
1145837525 17:27965856-27965878 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1146303104 17:31706634-31706656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146625535 17:34432272-34432294 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146684163 17:34829208-34829230 CTGTGTCCTCACATAGTGGAGGG - Intergenic
1146755125 17:35423861-35423883 CTGTGTTCTCACATAGTGGAAGG - Intronic
1146993396 17:37296257-37296279 TTGTGTCCTCACAGAGTGGAAGG + Intronic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1147403256 17:40193407-40193429 CTGGGTACTCACAAAGGGGCCGG - Exonic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1148534116 17:48424175-48424197 CTGTGTCCTCACATAGTGGAAGG + Intronic
1148586110 17:48781868-48781890 CTGTGTCCTCACACAGTGGAAGG - Intronic
1148971583 17:51487891-51487913 GTGTGTACTCAGATGGTTGATGG + Intergenic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1149983745 17:61331810-61331832 GTGTGTACTCAGCACGTGGCAGG + Intronic
1203184014 17_KI270729v1_random:94833-94855 CTATGTCCTCACATAGTGGAAGG + Intergenic
1153100914 18:1468599-1468621 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1153960768 18:10138157-10138179 CTGTGTAATCAGAATATGGTAGG - Intergenic
1154515740 18:15163320-15163342 CTATGTCCTCACATAGTGGAAGG - Intergenic
1154519032 18:15206835-15206857 CTATGTCCTCACATAGTGGAAGG - Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1156729562 18:40175162-40175184 CTGTGTTCTCACACAGTGAAAGG + Intergenic
1157416336 18:47506439-47506461 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157797332 18:50587285-50587307 CTGTGTCCTCTCACAGTGGAAGG - Intronic
1157889879 18:51405398-51405420 CTGTGTCCTCACATAGGGGATGG - Intergenic
1158087434 18:53669028-53669050 CTGAGTACAAAGAAAGTAGAAGG - Intergenic
1158620400 18:59027858-59027880 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1158860402 18:61586239-61586261 CTGTGTACTCACGTGGTGGAAGG + Intergenic
1159270379 18:66141563-66141585 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159462496 18:68738922-68738944 CTGTTTTCACACAAAGTGGATGG + Intronic
1159502756 18:69295017-69295039 CTGTGTCCTCACATATTGGAAGG + Intergenic
1160183342 18:76655117-76655139 CTGTGTTCTCACGCAGTGGAAGG + Intergenic
1160257582 18:77260254-77260276 CTGTATCCTCACAGAGTGGAAGG + Intronic
1161435255 19:4259021-4259043 CTGTGTCCTCAGAAGGCGGCTGG - Intronic
1162513198 19:11132127-11132149 CTCTGAACTGAGAAAGTGCAAGG - Exonic
1162522824 19:11192179-11192201 CTGTTTATTCAGTAAGTGGCAGG - Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165637575 19:37355109-37355131 ATATGTACTGAGAAAGGGGAAGG - Intronic
1168457054 19:56520688-56520710 CTGTTTCCTCACACAGTGGAAGG - Intronic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1168580634 19:57553056-57553078 CTGTGTTCTTACAAGGTGGAGGG - Intronic
1202672140 1_KI270709v1_random:65358-65380 CTATGTCCTCACATAGTGGAAGG + Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925483364 2:4301416-4301438 CTGTGTCCTCACATGGTGGAAGG - Intergenic
925554601 2:5115777-5115799 CTGTGTCCTCAAATCGTGGAAGG + Intergenic
925703998 2:6666793-6666815 CTGTGTCCTCCCATAGTGGAGGG - Intergenic
925969738 2:9098058-9098080 CCTTGTTCTCAGGAAGTGGACGG + Intergenic
926125922 2:10271865-10271887 TTGTGCGCTCAGACAGTGGAGGG + Intergenic
926259237 2:11242000-11242022 CTGTGTCCTCACACAGTAGAAGG - Intronic
926452892 2:13027307-13027329 CTGTGTCCTCACATGGTGGAAGG + Intergenic
927050513 2:19323638-19323660 CTGTGTCCTCACATTGTGGAAGG + Intergenic
927130926 2:20059845-20059867 CTGTGTCCTCACATAGTTGAAGG + Intergenic
927236738 2:20881695-20881717 CTGTGTTCTCAGAAAATGGCGGG - Intergenic
927311310 2:21634825-21634847 CTGTGTCCTCACATGGTGGAAGG - Intergenic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
928257163 2:29732740-29732762 CTGTGTCCTCACATGGTGGAAGG - Intronic
928306063 2:30171355-30171377 CTGTGTCCTCATACGGTGGATGG + Intergenic
928694017 2:33830421-33830443 CTGTGTCCTCACATGGTGGAAGG - Intergenic
929228114 2:39531623-39531645 CTGTGTCCTCACATGGTGGAAGG + Intergenic
929565563 2:42981944-42981966 CTGTGTCCTCAGACAGTGGAAGG + Intergenic
929821336 2:45276424-45276446 CTCTGGAATCAGAAAATGGAAGG + Intergenic
930107175 2:47649474-47649496 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930485172 2:52002362-52002384 CTGTGTTCTCACATAGTGGATGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930557677 2:52919812-52919834 CTGTGTTCTCACAGAGTGGAAGG - Intergenic
930851748 2:55968477-55968499 CTGTGTCCTCACATGGTGGAGGG - Intergenic
932322181 2:70830396-70830418 CAGTGTACTAAGGGAGTGGAAGG + Exonic
932721285 2:74140554-74140576 CTGTCTACTCAGGAAGTGTGAGG + Intronic
932744119 2:74317576-74317598 CTTTCTACTCAGAATATGGAGGG + Intronic
933133887 2:78707359-78707381 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933244691 2:79962290-79962312 CTGTGTTCTCACACAATGGAAGG + Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
933543676 2:83681431-83681453 CTGGGTAATCAGATACTGGAAGG - Intergenic
933593021 2:84253552-84253574 CTGTGTCCTCACATAGTGGAAGG - Intergenic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
933982398 2:87562410-87562432 CTGTGTCCTCACATGGTGGAGGG + Intergenic
934303590 2:91800447-91800469 CTATGTCCTCACACAGTGGAAGG + Intergenic
934329669 2:92052305-92052327 CTATGTCCTCACACAGTGGAAGG - Intergenic
934331968 2:92076863-92076885 CTATGTCCTCACACAGTGGAAGG + Intergenic
934467886 2:94282217-94282239 CTATGTCCTCACATAGTGGAAGG - Intergenic
935483980 2:103629859-103629881 CTGTGTCCTCACAGTGTGGAAGG - Intergenic
935515191 2:104027653-104027675 TTCTGTACTTAGAAAGTAGAAGG - Intergenic
935639885 2:105280620-105280642 CTGCGTACTCATGAAGAGGAGGG + Exonic
935809654 2:106785194-106785216 CTGTGTCCTCACATTGTGGAAGG + Intergenic
935889318 2:107658477-107658499 CTGTGTCCTCATACACTGGAAGG - Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
936614215 2:114032430-114032452 CTGACTTCTCAGAAATTGGATGG + Intergenic
936707123 2:115088083-115088105 CTGTGTCCTCACACGGTGGAAGG + Intronic
936859359 2:116998041-116998063 CTGTGTACCTAAAAAGTGGTAGG - Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937088620 2:119189621-119189643 CTGTGTCCTCACATGGTGGAGGG - Intergenic
937448999 2:121984961-121984983 CTGTGTCCTCATATGGTGGAAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938171031 2:129076822-129076844 TTGTGTCCTCACATAGTGGAAGG - Intergenic
938516001 2:132008096-132008118 CTATGTCCTCACATAGTGGAAGG - Intergenic
938519034 2:132047382-132047404 CTATGTCCTCACATAGTGGAAGG - Intergenic
938556852 2:132432270-132432292 CTGTGTCCTCACATGGTGGAAGG + Intronic
938706282 2:133930477-133930499 CTGTGTCCTCATATGGTGGAAGG + Intergenic
938786246 2:134632621-134632643 CTGTGTCCTCAAAGGGTGGAAGG + Intronic
939044226 2:137231123-137231145 CTGTGTGCTGAGCGAGTGGACGG + Exonic
939239736 2:139542302-139542324 ATGTGTGCTAAGAAAGTAGAAGG - Intergenic
939871738 2:147533650-147533672 CTGTGTCCTCACACTGTGGAAGG + Intergenic
940093089 2:149943977-149943999 CTGTGTCCTCACACAGTGAAAGG - Intergenic
940247872 2:151638740-151638762 CTGTGCACACTGAAAGTGAAAGG + Intronic
940307242 2:152239684-152239706 CTGTGTCCTCACATACTGGAAGG - Intergenic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941709439 2:168696681-168696703 CTGTGTCCTCACATGGTGGAAGG + Intronic
941807263 2:169722057-169722079 CTGTGTCCTCTCAAGGTGGAAGG - Intronic
941868648 2:170360791-170360813 CTGTGTCTTCACACAGTGGAAGG - Intronic
942870333 2:180726680-180726702 CTGTGTACTAATAAAGGGAAGGG + Intergenic
943195627 2:184744485-184744507 CTGTGTCCTCACATGGTGGAAGG - Intronic
943306827 2:186273261-186273283 CTGTGTCATCACATAGTGGAGGG - Intergenic
943971816 2:194419377-194419399 CAGTGTCCTCACACAGTGGAAGG - Intergenic
944029209 2:195213411-195213433 CTGTGTCCTTACATAGTGGAAGG - Intergenic
944167085 2:196734514-196734536 CTGTGTCCTCACATGGTGGAAGG - Intronic
944783734 2:203046656-203046678 CTGTGTCCTCACACAGAGGAAGG + Intronic
944890075 2:204108491-204108513 CTGTCCATTCATAAAGTGGAGGG + Intergenic
945321511 2:208429175-208429197 CATTGTACTCAGAAACTAGAGGG - Intronic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946113258 2:217438504-217438526 CTGTGTCCTCACATGGTGGAAGG - Intronic
946331533 2:219012018-219012040 CTGTGTCCTCACATGGTGGAGGG - Intronic
946550439 2:220795369-220795391 CTGTGTCCTCACAAAGTGAAAGG - Intergenic
946972348 2:225108558-225108580 CTGTGTCCTCACATGGTGGAAGG + Intergenic
947349838 2:229232012-229232034 CTGTGTCCTCACACAGTGGAAGG + Intronic
947361791 2:229352854-229352876 CTGTGTCCTCACATGGTGGAAGG - Intergenic
947814594 2:233027881-233027903 CTGTGTCCTCACATGGTGGAGGG + Intergenic
948027089 2:234786913-234786935 CTGTGTCCTCACGTAGTGGAAGG + Intergenic
948134252 2:235624369-235624391 CTGTGTCCTTAGACAGTAGATGG + Intronic
948512470 2:238477948-238477970 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948516375 2:238506298-238506320 CTGTGTCCTCACACAGCGGAAGG + Intergenic
948522903 2:238552243-238552265 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948668369 2:239550677-239550699 TTGTGTCCTCATATAGTGGAAGG + Intergenic
1168884084 20:1232974-1232996 CTGTGACCTCACACAGTGGAAGG - Intronic
1169594574 20:7183280-7183302 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169623708 20:7539112-7539134 CTGTTTTCTTTGAAAGTGGAAGG + Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169685834 20:8270288-8270310 CTGTGTACTTAGCAAGTTGAAGG - Intronic
1169752341 20:9007118-9007140 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169907155 20:10615837-10615859 CAGTGTCCCCACAAAGTGGAAGG + Intronic
1169939120 20:10917996-10918018 CTGTGTCCTCACACAGTGGAAGG - Intergenic
1170040377 20:12033940-12033962 CTGTGTGCTCACATAGTGGGAGG - Intergenic
1170796934 20:19556045-19556067 CTGTGTCCTCACATGGTGGAAGG + Intronic
1171336059 20:24386613-24386635 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1171563738 20:26156647-26156669 CTGTGTTCTGAGAATGTGGTTGG + Intergenic
1171726253 20:28623884-28623906 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171790447 20:29518379-29518401 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171857265 20:30358456-30358478 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1171902873 20:30873143-30873165 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172195283 20:33087310-33087332 ATGTGTACAAAGAAACTGGAAGG - Intronic
1172942116 20:38661220-38661242 GTGTGCACTCAGGAAGTGGAAGG + Intergenic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1173574586 20:44103943-44103965 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1175045199 20:56098637-56098659 CTGAGTACTCCCAAAGGGGAAGG - Intergenic
1175321118 20:58089060-58089082 CTATTTGCTCAGAGAGTGGATGG + Intergenic
1175369743 20:58480279-58480301 CAGTGCACTCAGAGAGTTGAAGG + Intronic
1175528849 20:59660080-59660102 CAGTGTCCTCTGAAAGTGGGGGG - Intronic
1175552380 20:59825946-59825968 CTGTGTCCTCACATGGTGGAGGG - Intronic
1175630971 20:60536140-60536162 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1175688044 20:61045612-61045634 CTGTGAACCCAGAAAGGGAAAGG - Intergenic
1175842331 20:62036936-62036958 GTGTGTCCTCAGAGTGTGGAAGG - Intronic
1175974939 20:62706073-62706095 CTGTGCACTCACAAACCGGATGG - Intergenic
1176742679 21:10618805-10618827 CTATGTCCTCACACAGTGGAAGG + Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177223781 21:18227090-18227112 CTGTGTCCTCACATAGTGGAAGG + Intronic
1177676249 21:24304671-24304693 CTGTGTCCTCATATAGTGAAAGG + Intergenic
1178097013 21:29226793-29226815 CTGTGTCCTCACATGGTGGAAGG + Intronic
1178482726 21:32993691-32993713 CTGTGTCCTCAGACAGTAGAAGG + Intergenic
1178641965 21:34352114-34352136 CTGAGTATTCAGAAAGGGCATGG - Intergenic
1179145950 21:38767577-38767599 CTGTGGAGTCTGAAAGTGGAGGG - Intergenic
1179954673 21:44731925-44731947 CTGTGTCCTCACACAGTGGAAGG + Intergenic
1180318953 22:11303461-11303483 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1180336263 22:11579113-11579135 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1180525563 22:16256260-16256282 CTATGTCCTCACATAGTGGAAGG + Intergenic
1181480692 22:23197540-23197562 CTGTATGCTCAGAAAGTAGCAGG + Intronic
1181886318 22:26024966-26024988 CTGTGTCATCACACAGTGGAAGG + Intronic
1181928966 22:26383974-26383996 CTGTGTCTTCACACAGTGGAGGG + Intergenic
1182101077 22:27657925-27657947 TTGTGTACTCCCAAAGTGCAGGG + Intergenic
1182336076 22:29584345-29584367 ATGTGTACTCAGTATGTGAAGGG + Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1182931144 22:34175482-34175504 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1182970118 22:34565967-34565989 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1184209196 22:43025300-43025322 CTGTGTGCCCAGACAGTGGGCGG + Intergenic
1185005075 22:48271056-48271078 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185201812 22:49511495-49511517 CTGTGTCCTCATATAGTGGAAGG - Intronic
1203289952 22_KI270735v1_random:26633-26655 CTATGTCCTCACATAGTGGAAGG - Intergenic
949372717 3:3352957-3352979 CTGTGTCCTCACATGGTGGAAGG - Intergenic
949806032 3:7956823-7956845 CTGTGTCCTCACATAGAGGATGG + Intergenic
949957077 3:9277967-9277989 CTGTGTCCTCACATGGTGGAAGG - Intronic
950531742 3:13556299-13556321 CTGTGTCCTCACAAGGTGGGGGG + Intronic
950588505 3:13916238-13916260 CTGTGTCTTCACATAGTGGAAGG + Intergenic
950896633 3:16457950-16457972 CTGTGTCCTCACATGGTGGAAGG - Intronic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
951080840 3:18447915-18447937 CTGTGTCCTCACACAGTGGAAGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951794709 3:26525420-26525442 CTGTGTCCTCACATAGTGGAAGG + Intergenic
952068816 3:29607408-29607430 CTGTGTCCTCACACTGTGGAAGG + Intronic
952434323 3:33257114-33257136 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952509820 3:34041834-34041856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
953120043 3:40031196-40031218 CTGTGTCCTCACATCGTGGAAGG + Intronic
953206706 3:40837682-40837704 CTGTGTTCTCATATGGTGGAAGG + Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
954784432 3:53082555-53082577 CTGTGTAATCAGACAGTCCAGGG + Intronic
955006031 3:54969777-54969799 CTGTGAAGGCAAAAAGTGGAGGG - Intronic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955515649 3:59724026-59724048 CTGTGTCCTCACATGGTGGAAGG + Intergenic
955525944 3:59819919-59819941 CTGTGTCCTCACATGGTGGAAGG - Intronic
955541440 3:59980692-59980714 CTGTGTCCTCACATGGTGGAAGG - Intronic
955952677 3:64257944-64257966 CTGTGTCTTCACACAGTGGAAGG - Intronic
956011233 3:64833777-64833799 CAGTGAATTCAGAAAGGGGAAGG + Intergenic
956747786 3:72323289-72323311 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
956840064 3:73131118-73131140 CTGTGTCCTCAGATGATGGAAGG + Intergenic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
957661218 3:83156022-83156044 CCGTGTCCTCACATAGTGGAAGG + Intergenic
957791057 3:84941851-84941873 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958411703 3:93825195-93825217 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958501847 3:94921002-94921024 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
958836023 3:99146024-99146046 CTGTGTCCTCACATGGTGGAAGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959217386 3:103469120-103469142 ATGTTTACTCAGAATGTGTATGG - Intergenic
959770190 3:110085671-110085693 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959862814 3:111235203-111235225 CTGTGTCCTCAAATAGTGGAAGG + Intronic
959910599 3:111759311-111759333 CTGTGTCCTCACATGGTGGAAGG + Intronic
960121594 3:113952805-113952827 CTGTGTCCTCACATGGTGGAAGG + Intronic
960260108 3:115557658-115557680 CTGTGACCTCACATAGTGGAAGG + Intergenic
960260503 3:115562846-115562868 CTCTCTACTCAGAAAGAGGATGG + Intergenic
960457538 3:117891496-117891518 ATGTGTACTCAAATAATGGAAGG + Intergenic
961152620 3:124652329-124652351 CTGAGTACTCACAAAGCTGAGGG - Intronic
961251802 3:125513217-125513239 CTGTGTCCTCACATGGTGGAAGG - Intronic
961657188 3:128449663-128449685 CTGTGTCCACAGAAAGTGAAGGG + Intergenic
961990000 3:131179124-131179146 CTGTGTCCTCACATGGTGGAAGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
962968655 3:140378682-140378704 CCTTGTACTCAGAAAGAGCATGG + Intronic
963071660 3:141309894-141309916 CTGTGTCCTCACATGGTGGAAGG - Intergenic
963262639 3:143208206-143208228 CTGTGTCCTCACATGGTGGAAGG + Intergenic
963530935 3:146472555-146472577 CCGGGTCCTCACAAAGTGGAAGG + Intronic
963627558 3:147692130-147692152 CTGTGCACTAATGAAGTGGAAGG - Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
963840311 3:150098009-150098031 CTGTGTCCTCTCATAGTGGAAGG - Intergenic
963989363 3:151635413-151635435 CTGTGTCCTCACATGGTGGAAGG + Intergenic
964340864 3:155707078-155707100 CTGTGTTCTCATATGGTGGAAGG - Intronic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
965211433 3:165794540-165794562 CTGTGTCCTCACATAGTAGAAGG + Intronic
965443457 3:168745607-168745629 CTGTGTCCTCACATGGTGGAAGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965759869 3:172064189-172064211 CTGTGTCCTCACATGGTGGAGGG - Intronic
965968294 3:174523004-174523026 CTGTGTCCTCACATGGTGGAAGG - Intronic
966003834 3:174983598-174983620 CTGTGTCCTCACATGGTGGAAGG + Intronic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966317706 3:178667431-178667453 GTGTGTCCTCACAAGGTGGAAGG - Intronic
966442295 3:179959172-179959194 CTGTCTACTCAAAGAGTGGTTGG - Intronic
966532139 3:180992923-180992945 CTGTGTTCTCACAGGGTGGAAGG - Intergenic
967013111 3:185457479-185457501 CTGTGTCCTCACGAGGTGGAAGG + Intronic
968144847 3:196289375-196289397 CTGTGGACAAAGAAAATGGATGG + Intronic
968915991 4:3497294-3497316 CTGTGTCCTCAGACAGCGGTGGG + Intronic
969281361 4:6172689-6172711 CTCTGTTCCCAGAAACTGGAAGG + Intronic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
969965157 4:10986474-10986496 CTGTGTCTTCATATAGTGGAAGG - Intergenic
970579103 4:17458040-17458062 CTGTGTCCTCAGACAGCAGAGGG - Intergenic
970860522 4:20697796-20697818 CTGTGTCCTCACATAGTGGAAGG + Intronic
970866247 4:20762192-20762214 CTGTGTTCCCACATAGTGGAAGG + Intronic
970901610 4:21165944-21165966 CTGTGTCCTCCCAAGGTGGAAGG - Intronic
971353885 4:25877050-25877072 CTGTGTCCTCACATGGTGGAAGG - Intronic
971390446 4:26180539-26180561 CTGTGTCCTCACAAGGTGAAAGG + Intronic
971905966 4:32726390-32726412 CTGTGTCCTCACACGGTGGAAGG + Intergenic
972226265 4:37016435-37016457 CTGTGTACTCACATAGTGGAAGG - Intergenic
972297133 4:37750634-37750656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
972990449 4:44817199-44817221 CTGTGTCCTCACATGGTGGAAGG + Intergenic
973075427 4:45918938-45918960 ATGTGTCCTCACAAAGTGGAGGG + Intergenic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
973755360 4:54068376-54068398 CTGTGTTCTAAGATAGTGGAAGG - Intronic
973766121 4:54164639-54164661 CTGTGTCCTCACACGGTGGAAGG + Intronic
974488948 4:62539265-62539287 CTGTGTCCTCACATAGTGAAAGG + Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
975241582 4:72066190-72066212 CTGTGTCCTTACAAGGTGGAAGG + Intronic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
976605938 4:86982891-86982913 CTGTGCCCTCACACAGTGGAAGG - Intronic
976745006 4:88393839-88393861 CTGTGTCCTCACATAGTGAAGGG + Intronic
976764498 4:88585099-88585121 CTGTGTCCTCACATGGTGGAAGG + Intronic
976898600 4:90143414-90143436 CTGTGTTCTCAGGAAGTTTATGG - Intronic
976980925 4:91227675-91227697 CTGTGGACTCCAAAAGGGGAAGG - Intronic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978285025 4:107066883-107066905 CTGTGTCCTCACATGGTGGAAGG - Intronic
978696567 4:111587184-111587206 CTGTGTCCTCACATGGTGGAAGG + Intergenic
978703809 4:111680805-111680827 CTTAGTACTTAGAAAGTGCATGG + Intergenic
978768914 4:112433312-112433334 CTGTGTCCTCACATAGTGGAAGG + Intronic
979458309 4:120951379-120951401 CTGAGTCCTCAGACAGTGGAGGG + Intergenic
979665777 4:123309358-123309380 CTGTGTCCTCACATGGTGGAAGG + Intronic
979727090 4:123975052-123975074 CTGTGTCCTCACATGGTGGAAGG - Intergenic
979935958 4:126696063-126696085 CTGTTTACAGAGAAAATGGAGGG + Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980727066 4:136776542-136776564 CTGTGTCCTCACATGGTGGAAGG - Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
981042951 4:140239721-140239743 CTGTGAGATCAGTAAGTGGAGGG + Intergenic
981552970 4:145960411-145960433 CTGTGTCCTCACAAGGTGAAAGG + Intergenic
982115333 4:152094235-152094257 CTGTGTCCTCACATGGTGGACGG - Intergenic
982203753 4:152981797-152981819 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982290479 4:153776637-153776659 CTGAGTACTCAGTATGTGCAAGG - Intergenic
982492143 4:156042811-156042833 CTGTGTCCTCACACAGTGGAAGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
982743202 4:159079337-159079359 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982980510 4:162128464-162128486 CTATGTACTCACATGGTGGAAGG - Intronic
983031802 4:162811939-162811961 CTGTGTATTCACATGGTGGAAGG + Intergenic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983748682 4:171235195-171235217 CTGTGTCCTCACATAGTGGAGGG + Intergenic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984559571 4:181252650-181252672 CTATGTCCTCACATAGTGGAAGG + Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
985434274 4:189913817-189913839 CTGTGTCCTCACATGGTGGAAGG - Intergenic
985493999 5:194273-194295 ACGTCCACTCAGAAAGTGGACGG - Intronic
985724353 5:1508011-1508033 CTGTGTCCTCGCAAGGTGGAGGG - Intronic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
986454228 5:7899552-7899574 CTGTGTGCTTTGAGAGTGGAGGG + Intronic
986575921 5:9213049-9213071 CTGTGTCCTCACAAGGTGGGAGG + Intronic
986616440 5:9622250-9622272 TTGTGTACTCTGAAAGGAGAAGG + Intergenic
986642550 5:9886715-9886737 ATGCGTAATCAGAAAGTGGTGGG + Intergenic
986670664 5:10140166-10140188 CTGTGTCCTCACATGGTGGAAGG - Intergenic
987225269 5:15833283-15833305 CTGTGTCCTCACATGGTGGAAGG + Intronic
987263437 5:16226998-16227020 CTGTGAACTCAAAAAGTGTTGGG + Intergenic
987302026 5:16605779-16605801 CTGTGTCCTCACATGGTGGAAGG + Intronic
988483094 5:31645930-31645952 CAGTGTACTCAGTAGGGGGAAGG + Intronic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
989193736 5:38695614-38695636 CTGTGAACTCAGTGAGTGTAAGG + Intergenic
989289408 5:39745937-39745959 CTGTGTCCTCACATGGTGGAAGG + Intergenic
989382394 5:40822269-40822291 CTGTGTCCTCATATGGTGGAAGG + Intergenic
989476109 5:41874964-41874986 CTGTGTCCTCACATAATGGAAGG + Intergenic
989518284 5:42370006-42370028 CTGTGTACTCTAAAAATAGAGGG + Intergenic
989980481 5:50637736-50637758 CTGTGTCCTCACATGGTGGAAGG - Intergenic
990055517 5:51572344-51572366 CTGTGTCCTCCGATGGTGGAAGG + Intergenic
990845220 5:60130044-60130066 CTGTGTCCTCACATGGTGGAAGG - Intronic
991335666 5:65544189-65544211 CTGTGTCCTCACATAGTGGAAGG + Intronic
991558255 5:67920849-67920871 CTGTGTCCTCACATGGTGGAAGG - Intergenic
991929051 5:71733624-71733646 CTGTGTCCTCATATGGTGGAAGG + Intergenic
992388037 5:76304701-76304723 CTGTGTCCTCACATGGTGGAAGG + Intronic
992734766 5:79707938-79707960 CTGAGTCCTCACACAGTGGATGG + Intronic
992747333 5:79832688-79832710 CTGAGTACTCACATGGTGGAGGG + Intergenic
992943481 5:81786401-81786423 CTGTGTCCTCACATGGTGGAAGG + Intergenic
993281706 5:85933455-85933477 CTGTGTCCTCACATGGTGGAAGG - Intergenic
993306648 5:86282988-86283010 CTGTGTTCTGAGAAACTGAACGG + Intergenic
994047713 5:95328358-95328380 CTGTGTCCTCACATGGTGGAAGG - Intergenic
995507978 5:112880296-112880318 CTTGGTAATTAGAAAGTGGAAGG - Intronic
995543946 5:113211212-113211234 CTGTGTCCTCACATAGTAGAAGG - Intronic
995597384 5:113762662-113762684 CTGTGTCCTCAAATAGAGGAAGG + Intergenic
996178303 5:120387367-120387389 CTGTGTCCTCACATGGTGGAAGG + Intergenic
996214022 5:120845879-120845901 CTGTGTCCTCACATGGTGGAAGG - Intergenic
996311894 5:122116014-122116036 TTGTGTCCTCACATAGTGGAAGG + Intergenic
996331271 5:122331680-122331702 CTGTGTCCTCACATGGTGGAAGG + Intronic
996543601 5:124654618-124654640 TTGTGAGCTCAGAAAGGGGAGGG - Intronic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
996837536 5:127810482-127810504 CTGTATACCCAGAAAGGAGAGGG + Intergenic
996920980 5:128767490-128767512 CTGTGTCCTCACATAGTGGAAGG - Intronic
997069675 5:130606655-130606677 TTGGGTACTTAGAAAGAGGAAGG - Intergenic
997219517 5:132149235-132149257 CTGTGTTCTCACATAGTGGGAGG + Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
1000196908 5:158968409-158968431 CTGTGAACTTACAAAGTGGGTGG + Intronic
1000239294 5:159394527-159394549 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1000259042 5:159568392-159568414 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000412774 5:160950880-160950902 CTGTGTACTCAGAATAAGAAAGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001446854 5:171792004-171792026 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001477429 5:172060490-172060512 CTGTATCCTCACATAGTGGAAGG - Intronic
1001553216 5:172619216-172619238 CTGTGTCCTCACACAGTGGAAGG + Intergenic
1001744247 5:174078748-174078770 CTGTGTCCTCACATGGTGGAAGG - Intronic
1002078500 5:176723844-176723866 CTGTGTACACAGAGAGGGGCTGG - Intergenic
1002807810 6:594081-594103 CTCTGTGCTGAGAAAGTGGCAGG + Intronic
1003253743 6:4456591-4456613 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003408947 6:5846548-5846570 CTGTGTACAGAGAGAGTGGGGGG + Intergenic
1003877037 6:10447073-10447095 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1004190652 6:13460891-13460913 CTGTGTCCTCACATGGTGGAAGG - Intronic
1004249890 6:14015198-14015220 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1004906053 6:20238348-20238370 CTCAGGACTCAGGAAGTGGATGG + Intergenic
1004951847 6:20681988-20682010 CTGTGTCCTCACACAGTGGAAGG + Intronic
1004997742 6:21210426-21210448 CTGTGTCCTCACACAATGGAAGG - Intronic
1007470345 6:42086011-42086033 CTGTGTCCTCACATGGTGGAAGG - Intronic
1007487421 6:42191114-42191136 CTGTCTACTCAGGAATAGGATGG + Intronic
1008283049 6:49618974-49618996 CTGTGTTCTCACACAGTGGAAGG + Intronic
1008668232 6:53738752-53738774 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1009304803 6:62075282-62075304 CTGTGTCCTCACATGGTGGAGGG - Intronic
1009516482 6:64625494-64625516 CTGTGTCCTCACATTGTGGAAGG + Intronic
1009763131 6:68034818-68034840 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1009878707 6:69538570-69538592 CTGTGTCCTCACAAAGCAGAAGG + Intergenic
1009929807 6:70163912-70163934 CTGTGTCCTCACATAGTAGAAGG + Intronic
1010367595 6:75069850-75069872 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010443023 6:75919982-75920004 CTGGGTCCTCTGAGAGTGGAAGG + Intergenic
1010495005 6:76523415-76523437 CTGTGGAGTCAGAATGTAGAGGG - Intergenic
1010649474 6:78434565-78434587 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1010765547 6:79774417-79774439 CTGTGTCCTCACACAGTGGAAGG + Intergenic
1010986967 6:82435703-82435725 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011127355 6:84021438-84021460 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011636573 6:89380264-89380286 GTGTTTATTCATAAAGTGGATGG - Exonic
1011859605 6:91738264-91738286 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1012926617 6:105274267-105274289 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014240967 6:119017087-119017109 TAGTGTTCTCAGAAAGTGAAAGG + Intronic
1014642160 6:123926010-123926032 CTGTGTCCTCACATGGTGGAAGG + Intronic
1014699873 6:124671696-124671718 CTATATACTCAGAGAGTGCAGGG - Intronic
1015684675 6:135846678-135846700 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1016199887 6:141394571-141394593 CTGCCAACTCAGAAAGGGGAGGG - Intergenic
1016291367 6:142531745-142531767 TTTTGTCCTAAGAAAGTGGATGG - Intergenic
1016353177 6:143189992-143190014 CTGTGTCCTCACATGGTGGAAGG + Intronic
1016499692 6:144705519-144705541 CTGTGTCCTCCCATAGTGGAAGG + Intronic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1016670085 6:146694364-146694386 CTGTGTACTCACCTAGTGGAAGG + Intronic
1017125469 6:151060422-151060444 CTGTGAACTCTGCAAGTGCAAGG - Intronic
1017187486 6:151616803-151616825 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017244988 6:152214648-152214670 CTGTGTCCTCACACAGTGGAAGG - Intronic
1017292523 6:152756985-152757007 CTCTGTGCTCTGAAAGTGTATGG - Intronic
1017595650 6:156025907-156025929 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1017609058 6:156165073-156165095 CTGTGTCCTCATCAAGTGGGAGG - Intergenic
1017852345 6:158315790-158315812 CTGTGTCCTCACATGGTGGAAGG + Intronic
1018520576 6:164645662-164645684 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1019696596 7:2449808-2449830 ATGTGTCCTCAGACAGTGGCTGG + Intergenic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1020676080 7:11186446-11186468 CTGTGTCCTCACAAGGTAGAAGG - Intergenic
1020725501 7:11808346-11808368 CTGTGTCCTCACACGGTGGAAGG - Intronic
1020920836 7:14262406-14262428 TTGTGTCCTCACAAAGTAGAAGG - Intronic
1021258846 7:18428860-18428882 GTGTGTGCTCAGCATGTGGATGG - Intronic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1021863658 7:24932598-24932620 CTGTGTGCTCACAGGGTGGAAGG - Intronic
1022197572 7:28083483-28083505 ATGTGAACTCAGAAAATGTATGG + Intronic
1022539101 7:31119699-31119721 CCGTGTCCTCATAGAGTGGAAGG + Intergenic
1022577596 7:31513271-31513293 CTGTGTGCTCAGAAAATGGGTGG - Intergenic
1022647614 7:32245794-32245816 CTGTGTCCTCACATGGTGGAAGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023823344 7:43992265-43992287 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1023961391 7:44929592-44929614 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1024114290 7:46177755-46177777 CTGTGTCCTGACAAGGTGGAAGG - Intergenic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1024335140 7:48199417-48199439 CTGTGTTCTCACATAATGGAAGG + Intronic
1025321746 7:58101885-58101907 CTATGTCCTCACATAGTGGAAGG + Intergenic
1025481034 7:60983205-60983227 CTATGTCCTCACATAGTGGAAGG + Intergenic
1025565978 7:62434647-62434669 CTATGTCCTCACATAGTGGAAGG + Intergenic
1025838041 7:65114462-65114484 CTATGTCCTCACATAGTGGAAGG + Intergenic
1025885031 7:65581511-65581533 CTATGTCCTCACATAGTGGAAGG - Intergenic
1027617649 7:80443650-80443672 CTGTGTCCTCACATGGTGGAAGG + Intronic
1027654722 7:80916402-80916424 CTGTGTACTCACAGAGGAGATGG - Intronic
1027965156 7:84994752-84994774 GTGTGTCCTCACATAGTGGAAGG - Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028662432 7:93295289-93295311 CTGTATCCTCAAATAGTGGAAGG + Intronic
1029751604 7:102545717-102545739 CTGTGTCCTCATATGGTGGAAGG + Intronic
1029769557 7:102644808-102644830 CTGTGTCCTCATATGGTGGAAGG + Intronic
1030422163 7:109321158-109321180 CTGTGTCCTCACTAGGTGGAAGG + Intergenic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1030465191 7:109892621-109892643 GGGTGTTCTCAGAAAGTGAAGGG - Intergenic
1031213514 7:118860749-118860771 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1031656783 7:124365575-124365597 CTGTCTACTCACATAGTGGGAGG + Intergenic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1032741711 7:134746273-134746295 CTGTGTCCTCACAGAGTGAAGGG - Intronic
1033037226 7:137886006-137886028 CTGTGTCCTCTCATAGTGGAAGG - Intronic
1033380801 7:140816263-140816285 CTGTCTACACAGAAACTGAATGG + Intronic
1034214341 7:149393629-149393651 CTGTATGCTCACAGAGTGGAAGG + Intergenic
1034217597 7:149420441-149420463 CTGTGAACCTAGAAAGGGGAAGG + Intergenic
1034544642 7:151781793-151781815 CTGTGTGGTCAGAACTTGGATGG - Intronic
1035921680 8:3683279-3683301 CTGTGGACCCAGAATATGGATGG + Intronic
1035969632 8:4233544-4233566 CTGTGTCCTCAGACAGTGGAAGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1037626799 8:20615255-20615277 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1038355726 8:26827560-26827582 CCGTGTCCTCACAAGGTGGAAGG + Intronic
1038381268 8:27096598-27096620 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1038867175 8:31452006-31452028 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1038897893 8:31807086-31807108 GTGTCTACTCAGAATGTGGCCGG - Intronic
1039274754 8:35923174-35923196 CTGTGTCCTCACCTAGTGGAAGG + Intergenic
1039705785 8:40005999-40006021 CCGTGTCCTCACATAGTGGAAGG - Intronic
1040049390 8:42997187-42997209 CTCTGCACTCAGGAAGTGGGTGG - Intronic
1040542762 8:48374649-48374671 CTGTGTCCTCACAACATGGAAGG + Intergenic
1041291954 8:56316497-56316519 CTCTGTATTCAGAAAGTGGGAGG + Intronic
1042411409 8:68470739-68470761 CTGTGTCCTCACATGGTGGAAGG + Intronic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1042775884 8:72430808-72430830 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1042787223 8:72561517-72561539 CCTTGTCCTTAGAAAGTGGAAGG - Intronic
1043022429 8:75020500-75020522 CTGTGTCCTCACATGGTGGAGGG + Intronic
1044097068 8:88079809-88079831 CTGTGTTCTCACACAGTGGAGGG - Intronic
1045490655 8:102666521-102666543 CTGTGCCCTCAGACAGTAGAAGG + Intergenic
1046264051 8:111807789-111807811 CTGTGTCCTCACAGAGTGGAAGG + Intergenic
1046308617 8:112403589-112403611 CTGTGTCCTCACATGGTGGAAGG + Intronic
1046358204 8:113115943-113115965 CTGTGTCCTCACATAGAGGAAGG - Intronic
1046926291 8:119792778-119792800 ATGTGTCCTCACAAGGTGGAAGG - Intronic
1047432862 8:124807665-124807687 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1047597448 8:126393272-126393294 CTGTGTTCTCATAATGTGGAAGG - Intergenic
1048232076 8:132652210-132652232 CTGTGTACTCTGCAAGTGGGTGG - Intronic
1048320361 8:133395072-133395094 CTGTGTCCTCACAGAGTGGAAGG - Intergenic
1048465552 8:134662147-134662169 CTGTGTCCTCACATGGTGGAAGG + Intronic
1049266289 8:141669566-141669588 CTGTGTCCTCACACAGTTGAAGG - Intergenic
1050057302 9:1669045-1669067 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1050288159 9:4125650-4125672 GTGTGTATTCAGAAAGAGAACGG + Intronic
1050373560 9:4947464-4947486 CTGTAATCTCAGAAACTGGAAGG - Intergenic
1050459362 9:5864298-5864320 CTGTTTACTCAGTAAGGGAAAGG + Intergenic
1050529530 9:6576306-6576328 CTGTGTCCTCACATGGTGGAAGG + Intronic
1051251218 9:15160954-15160976 CTGTGTCATCCCAAAGTGGAAGG + Intergenic
1051737377 9:20215162-20215184 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1051758680 9:20435631-20435653 CTATGTAGGCAGAAAGTGGGAGG + Intronic
1051910707 9:22152197-22152219 CTGTGTCCTCACATAGTAGAAGG - Intergenic
1052100297 9:24437980-24438002 CTGTGTCCTCACATAATGGAAGG + Intergenic
1052105086 9:24504607-24504629 CTTTGTACTCAGGAAGTCAAGGG - Intergenic
1052116647 9:24656579-24656601 CTGTGTCCTCACACAGTGGACGG + Intergenic
1052234353 9:26191996-26192018 CTGTGTCCTCACATAGTGGCAGG - Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052362055 9:27572661-27572683 CTTTGTATTCAGAAACAGGAGGG - Intronic
1052378735 9:27746145-27746167 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1052449503 9:28610563-28610585 CTGTGTTCACAGGTAGTGGAAGG - Intronic
1052528127 9:29647759-29647781 CTGTGTCCTCAGATGATGGAAGG - Intergenic
1053039933 9:34862057-34862079 CTGTGTCCTCACACGGTGGAAGG + Intergenic
1053723363 9:40971979-40972001 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1053944313 9:43290504-43290526 CTATGTCCTCAGACAGTGGAAGG - Intergenic
1053946481 9:43314287-43314309 CTATGTCCTCAGACAGTGGAAGG + Intergenic
1054408390 9:64783834-64783856 CTATGTCCTCACACAGTGGAAGG - Intergenic
1054702233 9:68424399-68424421 CTGTGTCCTCACATGGTGGAAGG + Intronic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055618210 9:78095112-78095134 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1056461557 9:86814069-86814091 TTGTGTCCTCACAAAGTGGAAGG + Intergenic
1057043219 9:91862707-91862729 CTGTGTCCTCACATGGTGGAGGG - Intronic
1057057790 9:91977315-91977337 CTGTGTTCTCACTTAGTGGAAGG - Intergenic
1057135046 9:92681696-92681718 CTGTGTCCCCACATAGTGGAAGG + Intergenic
1057673306 9:97114895-97114917 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058890737 9:109358517-109358539 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058983179 9:110188864-110188886 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1059142950 9:111871160-111871182 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1059465147 9:114464452-114464474 CTGTGTCCTCACATGGTGGAAGG + Intronic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1060043328 9:120320444-120320466 CTGTGTTCTCACATCGTGGAAGG + Intergenic
1060046855 9:120348354-120348376 GTGTCCACTGAGAAAGTGGATGG + Intergenic
1060979582 9:127784933-127784955 TTGTGTACTCAGGAAGTGCTGGG - Intergenic
1062102617 9:134736339-134736361 CTGTGTCCTCACATAGCGGAAGG + Intronic
1203451786 Un_GL000219v1:124002-124024 CTGTGTCCTCACATAGTGGAAGG + Intergenic
1203367178 Un_KI270442v1:269211-269233 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1203581854 Un_KI270746v1:14519-14541 CTATGTCCTCACATAGTGGAAGG + Intergenic
1203587449 Un_KI270747v1:19082-19104 CTATGTCCTCAGACAGTGGAAGG - Intergenic
1203589611 Un_KI270747v1:42845-42867 CTATGTCCTCAGACAGTGGAAGG + Intergenic
1185641253 X:1589682-1589704 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185808302 X:3080661-3080683 CTGTGTCCTCACATGGTGGAAGG + Intronic
1185827385 X:3264909-3264931 CTGTGTCCTCACACGGTGGAAGG - Intergenic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1185855439 X:3530648-3530670 CTATGTCCTCACATAGTGGAAGG + Intergenic
1185869679 X:3653257-3653279 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185872258 X:3673897-3673919 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185876327 X:3705242-3705264 CTGTGTCCTCATATAGTGGAAGG + Intronic
1185876760 X:3708188-3708210 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185962717 X:4563346-4563368 CTGTGTCCTCACACAGTGGAAGG + Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186029146 X:5347778-5347800 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186054869 X:5639407-5639429 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186057090 X:5661289-5661311 CTGTGTCCACACATAGTGGAAGG - Intergenic
1186066796 X:5775268-5775290 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186146219 X:6626957-6626979 CTGTGTTCTCACATAGTAGAAGG + Intergenic
1186170547 X:6872009-6872031 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186178797 X:6952750-6952772 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186228984 X:7432099-7432121 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186281575 X:7998803-7998825 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186364411 X:8876014-8876036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186408755 X:9327143-9327165 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1186620860 X:11238697-11238719 CTGGTTTCTCACAAAGTGGAGGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186939770 X:14492946-14492968 CTGTGTCCTCATATGGTGGAAGG + Intergenic
1186987056 X:15028489-15028511 CTGTGTCCTCATATGGTGGAAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187617858 X:21017669-21017691 TTTTGTTCTCAGCAAGTGGAGGG - Intergenic
1188425567 X:30043278-30043300 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1189554201 X:42125509-42125531 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1190242418 X:48667836-48667858 TTGTGTCCTCACATAGTGGAAGG + Intergenic
1190370326 X:49734129-49734151 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1190895908 X:54617735-54617757 CTGTGTTCTCACACAGTGGAAGG - Intergenic
1192305138 X:69951236-69951258 CTGTGTACTCACATGATGGAAGG - Intronic
1193136951 X:77983008-77983030 CTGTGTCCTCACATGGTGGAAGG + Intronic
1194785850 X:98083605-98083627 CTCTGTCCTCACAAGGTGGAAGG - Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1195407730 X:104535157-104535179 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1195987617 X:110647312-110647334 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1196021727 X:110997876-110997898 CTGTGTCCTCACGTAGTGGAAGG - Intronic
1196076740 X:111586080-111586102 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1196323218 X:114368813-114368835 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567229 X:117222411-117222433 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197149721 X:123206970-123206992 CTGAGTACATAGAAAGTGAAGGG - Intronic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1197827890 X:130610201-130610223 CTGTGTCCTCACAAAGCAGAAGG - Intergenic
1197914179 X:131516866-131516888 CTGTGTCCTCACATAGTGGAAGG - Intergenic
1198671778 X:139088914-139088936 CTGTGTCCTCACATGGTGGAAGG - Intronic
1198891844 X:141404996-141405018 CTGTGTCCTCACATGGTGGATGG - Intergenic
1199585255 X:149408248-149408270 CTGTATCCTCACATAGTGGAAGG - Intergenic
1199589371 X:149452115-149452137 CTGTGTACTCACGTGGTGGAAGG - Intergenic
1200788603 Y:7280222-7280244 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200789044 Y:7283469-7283491 CTGTGTCCTCATATAGTGGAAGG - Intergenic
1200791646 Y:7304784-7304806 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200842324 Y:7795392-7795414 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1200987288 Y:9316178-9316200 CTGAGGACTCAGAAGTTGGATGG + Intergenic
1201885018 Y:18872712-18872734 CTGTGTCCTCACACTGTGGAAGG + Intergenic
1201962597 Y:19698691-19698713 CTGTGTTCTCACACAGTGGAAGG + Intergenic