ID: 953446868

View in Genome Browser
Species Human (GRCh38)
Location 3:42975912-42975934
Sequence CTGGTGCAGGGAGGTATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953446864_953446868 -5 Left 953446864 3:42975894-42975916 CCTTCAGGATGGGGAGGACTGGT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 953446868 3:42975912-42975934 CTGGTGCAGGGAGGTATGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953446868 Original CRISPR CTGGTGCAGGGAGGTATGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900243673 1:1628248-1628270 GTGGAGCAGGGAGGTTGGTCTGG - Intronic
900398015 1:2461219-2461241 CTGTTGCAGGGGGGTAGGGCTGG + Intronic
900509201 1:3050445-3050467 CTGTTGCAGGGAGGGACCTCAGG + Intergenic
900920523 1:5667567-5667589 CTGGTGCAGGGATGCATGGTGGG - Intergenic
901691032 1:10973618-10973640 CTGCAGCAGGGAGGTGTGGCTGG + Intronic
902363851 1:15958293-15958315 CTGGTGCAGGGAGGTCACTTGGG - Intronic
902601119 1:17540512-17540534 CTGGAACAGGGATATATGTCAGG + Intronic
905581675 1:39087115-39087137 GAGGTGCAGGGGGGCATGTCTGG + Intronic
905896091 1:41546719-41546741 CTGATGCAGGGAGGCATGTAAGG - Intronic
907248596 1:53123280-53123302 CTGGTGCAGGGAGGGGAGGCAGG - Intronic
908263467 1:62356577-62356599 CTGGTGCAGGGTGGCAAGTATGG + Intergenic
908667310 1:66507818-66507840 CTGGTGCAAAGTGGTTTGTCAGG - Intergenic
911097040 1:94063190-94063212 CTGGTCCAGGGATACATGTCAGG + Exonic
912731390 1:112109337-112109359 TTGGTGCAGGGAAGAATGTGGGG + Intergenic
912764575 1:112396638-112396660 CAGGTGTAGGGAGGGATGTTTGG - Intronic
912942931 1:114061072-114061094 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
913494965 1:119420078-119420100 CTGGTTCACAGAGGTCTGTCAGG + Intronic
913497692 1:119443545-119443567 CTGGTTCACAGAGGTCTGTCAGG + Intergenic
913508751 1:119543457-119543479 CTGGTTCACAGAGGTCTGTCAGG + Intergenic
914916014 1:151819691-151819713 ATGGGGCAGGGAGATGTGTCTGG - Intronic
915671802 1:157495466-157495488 CTGGTGGAGGCAGGTGTGTTGGG + Intergenic
915745968 1:158158128-158158150 TTGGGTCAGGGAGGTATGGCAGG + Intergenic
916478250 1:165190801-165190823 CTGGTGCAGGGTGAAATGCCAGG + Intergenic
920197794 1:204241191-204241213 CTCCTGCAGGGAGATGTGTCAGG - Intronic
923036461 1:230288130-230288152 CTGGTTCAGGTGGGGATGTCTGG + Intergenic
1062896693 10:1108783-1108805 CTGGGGCAGGGAGCTGTGCCAGG - Intronic
1067719836 10:48719927-48719949 CTGGTGAAGGGTGGCATGGCAGG + Intronic
1070567180 10:77612803-77612825 TTGGGGCAAGGAGGTGTGTCAGG - Intronic
1071863718 10:89702371-89702393 CTGGTTCAGTGATGCATGTCTGG + Intronic
1073831102 10:107384545-107384567 CTGAAGCAGGGAGGAATGTGTGG - Intergenic
1074755406 10:116620966-116620988 CTGGTGCAGCATGGTAAGTCAGG + Intronic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1076249861 10:128977342-128977364 CTGGTCCAGGGAGGGCTTTCTGG - Intergenic
1076553206 10:131301051-131301073 GTGGTGCAGGGATGTAAGGCTGG - Intronic
1077071498 11:676077-676099 CAGGTGCTGGGGGGGATGTCGGG - Intronic
1078151095 11:8760235-8760257 CAGGGGAAGGGAGGTATGGCAGG - Intronic
1078867045 11:15307643-15307665 CTGCTGCAGTGAGGGGTGTCAGG - Intergenic
1080690131 11:34549491-34549513 CTGGTGTGGGGAGGCATGCCGGG + Intergenic
1081641820 11:44761186-44761208 CTGGGGCTGGGAGGGTTGTCGGG + Intronic
1082750212 11:57006524-57006546 CTGCAGCAGGGAGGTGTGGCTGG - Intergenic
1083339432 11:61949620-61949642 CTGGTGGAGGGGGGTGAGTCTGG - Intergenic
1089562574 11:119351727-119351749 CAGGTGCATGGTGCTATGTCTGG + Intergenic
1090226311 11:125074158-125074180 CTGGGGCAGGGAGGACTGCCAGG - Intronic
1090446467 11:126768797-126768819 CTGGGGAAAGGAGGTATGGCAGG + Intronic
1091669106 12:2439573-2439595 CTGGGGCAGGGAGGCAAGTCAGG + Intronic
1092039015 12:5367085-5367107 CTGATGCTGGGAGGTTTGTTGGG + Intergenic
1092263794 12:6966115-6966137 CTGGTGAATGGAGGGATGTTAGG - Intronic
1093281664 12:17203594-17203616 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1100948374 12:99815640-99815662 CTGGTGGAGGGAGGTTTGGAGGG - Intronic
1101257425 12:102992413-102992435 ACGGTGGAGGGAGGTCTGTCAGG + Intergenic
1101663964 12:106792904-106792926 CTGGTGCAGGGAAGAATATACGG + Intronic
1102328664 12:112011255-112011277 CTGCAGCAGGGAGGTGTGACTGG - Intronic
1104083836 12:125457012-125457034 CTGCTGCAGGCAGGTCTGGCTGG + Intronic
1108438465 13:50425005-50425027 CATGTGCAGGGAGGGATCTCAGG - Intronic
1112017101 13:95340355-95340377 CTGGGGCAGGGAGGTTTGGCAGG + Intergenic
1112287804 13:98119310-98119332 CTGGTGCAGGCAGGGAGGTGAGG + Intergenic
1115171772 14:30516453-30516475 CTGGTGTAGGGATGGCTGTCAGG - Intergenic
1115464367 14:33698660-33698682 CTGAGGAAGGGAAGTATGTCAGG - Intronic
1119113387 14:71996193-71996215 TTGGTGTGGGGAGGTTTGTCTGG - Intronic
1121509644 14:94502852-94502874 CTGGGGCAGGAAGGGGTGTCTGG - Intronic
1122183876 14:99974686-99974708 CCGGTGCAGAGAGGCATCTCAGG - Intronic
1123065896 14:105619030-105619052 CTGGTGCACGGAGCTTTCTCAGG - Intergenic
1123070053 14:105638276-105638298 CTGGTGCACGGAGCTTTCTCAGG - Intergenic
1123074645 14:105661938-105661960 CTGGTGCACGGAGCTTTCTCAGG - Intergenic
1123089292 14:105735063-105735085 CTGGTGCACGGAGCTTTCTCAGG - Intergenic
1123095079 14:105763220-105763242 CTGGTGCACGGAGCTTTCTCAGG - Intergenic
1128800930 15:70496403-70496425 TGGGTGCAAGGATGTATGTCTGG + Intergenic
1129603563 15:77013906-77013928 CTGGTGGAGGAAGGTGTGTAGGG + Intronic
1129774780 15:78229662-78229684 CTGGCCCAGGGAGGGCTGTCAGG - Intronic
1130389201 15:83440151-83440173 CTGCTGCAGCCAGGTATGTGAGG + Intergenic
1130929773 15:88415652-88415674 CAAGTGCAGGGAGGTATCTGAGG + Intergenic
1131287207 15:91070091-91070113 CTGGTGCAGGGAGGTCAGGGGGG + Intergenic
1132898026 16:2238111-2238133 CTGGTGCAGGGAGGAAGCTGAGG - Intronic
1133365809 16:5208769-5208791 TTGGTACTGGGAGGTATGTATGG - Intergenic
1135487032 16:22874703-22874725 CTGGGGCCTGGAGGTATGCCAGG - Intronic
1136155601 16:28380124-28380146 CTGGTCCAGGGAGGCCTGACAGG + Exonic
1136207483 16:28735165-28735187 CTGGTCCAGGGAGGCCTGACAGG - Exonic
1137724087 16:50645453-50645475 CTGGTGCAGGCCTGTATGGCCGG + Intergenic
1138157397 16:54718804-54718826 CTGGTGCAGGCAGGGAGGACTGG - Intergenic
1138503371 16:57462922-57462944 CTGGTGCAGGGGGGCAGCTCTGG - Intronic
1138605576 16:58086243-58086265 CAGGGGCAGGGAGGGATCTCCGG + Intergenic
1139330067 16:66181419-66181441 CTGCTGCAAGGAGTAATGTCTGG - Intergenic
1140207972 16:72948982-72949004 ATGGTGCAGTGAGGAAGGTCTGG - Intronic
1141459113 16:84166726-84166748 CTGGTGCTGGCAGGTAGGTGAGG - Intronic
1141798180 16:86288565-86288587 TTGGGGCAGGGAGGCATGGCAGG - Intergenic
1141799502 16:86297250-86297272 CTTGGGCAGGGAGGAAAGTCAGG + Intergenic
1143208719 17:5166837-5166859 GGGGTGCAGGGATGTATGTTGGG - Intronic
1143564370 17:7712468-7712490 CTGGGGCAGGGTGGTGTGTGAGG + Intergenic
1144310627 17:14010989-14011011 CTGGTGCATGGAGTCCTGTCAGG - Intergenic
1145807850 17:27747167-27747189 CTGGTGCTGGGAGGTAGGGGAGG - Intergenic
1147608870 17:41789731-41789753 CTTGTGAAAGGAGGTATGTAGGG + Intergenic
1147910701 17:43854278-43854300 CTGGGGCAGGGAGAGAGGTCAGG - Intronic
1148751087 17:49946314-49946336 CTGAGGCAGGGAGGTGTGTGAGG - Intergenic
1148775271 17:50091742-50091764 CTGGTGGAGGGAGGTGGGGCAGG - Intergenic
1150614429 17:66758117-66758139 CTGGTGCAGGGGGCTATGGGTGG - Intronic
1150950759 17:69800893-69800915 CTGCAGCAGGGAGGCATGGCTGG + Intergenic
1151184639 17:72354395-72354417 CAGGAGCAGTGAGGTATCTCTGG + Intergenic
1152371457 17:79891096-79891118 CTGGGGCGGGGAGGGAGGTCAGG + Intergenic
1152467744 17:80475533-80475555 CTGGTGCAGGGAGGTCAGGGCGG + Exonic
1153675782 18:7454802-7454824 CTGGTGCAGGTAAAGATGTCTGG + Intergenic
1154006155 18:10528760-10528782 CTGGGGCAGGGAGGTGGGGCGGG + Intronic
1156119294 18:33822324-33822346 ATGGTTCAAGGAGCTATGTCTGG + Intergenic
1158418937 18:57275512-57275534 CTGGAGGAGGGAGGTCTGTCTGG - Intergenic
1159655411 18:71026346-71026368 ATGGCCCAGGAAGGTATGTCTGG + Intergenic
1160292683 18:77608937-77608959 CTGCAGCAGGGAGGCATGGCTGG + Intergenic
1162866873 19:13554649-13554671 ATGCTGCAGGGAGGAATGTTCGG - Intronic
1164509441 19:28885481-28885503 CTGGTGCAGGGGAGCATGGCTGG + Intergenic
924974686 2:161675-161697 CTGAGGCAGGGATGAATGTCGGG + Intergenic
926859432 2:17292440-17292462 CTGCAGCAGGAAGGCATGTCTGG - Intergenic
927084504 2:19661030-19661052 TTGGGGCAGGGAGTTATTTCTGG + Intergenic
927509102 2:23633168-23633190 CGGGTACAGGGAGCTTTGTCTGG + Intronic
929591380 2:43149308-43149330 CTGGTGCAGGGAAGGATGGGTGG + Intergenic
929664608 2:43823855-43823877 CTGGAGAAGGGAGGTATTTAGGG + Intronic
932664225 2:73684073-73684095 ATGGTGCAGAGAGGTCTGGCAGG - Intergenic
934679396 2:96271898-96271920 ACGGTGCAGGGAGGTATATGAGG - Intronic
934699731 2:96429994-96430016 CTGCAGCAGGGAGGCATGGCTGG + Intergenic
935518915 2:104079050-104079072 CTGCAGCAGGGAGGCATGTCTGG - Intergenic
936278874 2:111121453-111121475 CTGGTGAAGGGTCGTAGGTCCGG + Intronic
936918583 2:117664643-117664665 CATGTGCTGGGAGGTATGTAAGG + Intergenic
937914432 2:127092081-127092103 GTGGTGGAGGGTGGTATGTGGGG - Intronic
939061002 2:137421329-137421351 CTGGTGCCTGGAGGTATGGGAGG - Intronic
939221234 2:139303863-139303885 CTGGTGCAGGAAGTAATGACTGG + Intergenic
939549989 2:143603259-143603281 CTGGTGCAGAGAGTTACCTCAGG + Intronic
940055932 2:149512435-149512457 CGGGTGCAGGGAGGTAGGGGAGG - Intergenic
946783590 2:223219120-223219142 CTGGGGAAGGGAGGAATGTTTGG - Intergenic
947152035 2:227125621-227125643 CTGGTGCAGGGAGGTCAGGGTGG - Intronic
947335114 2:229073986-229074008 ATGATGCAGGGAGGTAAGTATGG - Intronic
947820322 2:233064425-233064447 CTGGTGAAGCCAGGTCTGTCCGG - Intronic
948643579 2:239390212-239390234 ATTGAGCAGGGAGGTATTTCTGG - Intronic
1168812655 20:715843-715865 CTGGAGCAGAGAGTTATGTGGGG + Intergenic
1169536681 20:6551435-6551457 CTGGTGGTTGGAGGTATATCTGG + Intergenic
1171774160 20:29350111-29350133 CTGGTGCAGGGATGCATGGCGGG + Intergenic
1171816181 20:29787732-29787754 CTGGTGCAGGGATGCATGGCGGG + Intergenic
1171902183 20:30868310-30868332 CTGGTGCAGGGATGCATGGCGGG - Intergenic
1172283462 20:33724445-33724467 CTGATGCCGGGCCGTATGTCAGG - Intergenic
1172618767 20:36306606-36306628 CCGGTTCAGGGAGGTCTGTCGGG - Intronic
1172693937 20:36808815-36808837 CAGGGGCAGGGAGGAAAGTCTGG + Intronic
1175758408 20:61544786-61544808 CGGGGGCAGGGAGGGCTGTCGGG - Intronic
1175815141 20:61879437-61879459 CTGGTGCTGAGAAGTATCTCTGG - Intronic
1180131753 21:45831106-45831128 CAGCTGCAGGGAGGCAAGTCAGG - Intronic
1180319627 22:11308265-11308287 CTGGTGCAGGGATGCATGGCGGG + Intergenic
1180335558 22:11574245-11574267 CTAGTGCAGGGATGCATGGCGGG - Intergenic
1182557801 22:31138437-31138459 CTGGGGCATGGAGGGCTGTCTGG + Intronic
1183317800 22:37146441-37146463 CTTGTGCAGGCAGGTAGGTGCGG - Intronic
1183441966 22:37828255-37828277 CTGGAGCAGAGAGGTCAGTCAGG + Intergenic
1183606344 22:38868641-38868663 CTGGGGCAGGGAGGCTTGTTAGG + Intronic
1183948468 22:41339819-41339841 CTGGTCCAGGGTGGCCTGTCTGG + Exonic
1184019066 22:41808480-41808502 CTGCTGCAGGGAGGGAGGTCTGG - Intronic
1184260713 22:43314199-43314221 CTTGTGCAGGAAGCTTTGTCAGG + Intronic
949484399 3:4523849-4523871 CTGGTGCTTGGATGTATGTATGG + Intronic
950081876 3:10228391-10228413 ATGCTGCAGAGAGGTCTGTCTGG + Intronic
950282522 3:11719852-11719874 CTGGGGCAGTGAGGTTTGTCGGG + Intronic
950581106 3:13862654-13862676 GGGGTGCAGGGAGCTGTGTCTGG + Intronic
952862266 3:37822815-37822837 CAGGTGCATGCAGTTATGTCTGG + Exonic
953446868 3:42975912-42975934 CTGGTGCAGGGAGGTATGTCAGG + Intronic
957206828 3:77209759-77209781 CTGGTCCAAGGATGAATGTCAGG + Intronic
962481970 3:135805899-135805921 CTGGGGCAGGGAGGGAAGGCAGG - Intergenic
963042430 3:141079560-141079582 CTGGTGCAGGGATAGATGCCTGG - Intronic
965272569 3:166638150-166638172 CTGCAGCAGGGAGGCATGGCTGG + Intergenic
967778621 3:193411657-193411679 CTGGAGTAGGAAGGTATGTTTGG - Intronic
967850720 3:194080699-194080721 CTGGCCCTGGGAGGGATGTCGGG - Intergenic
969462421 4:7335821-7335843 CTGCTGCAAGGAGGGATGCCTGG + Intronic
969537820 4:7767570-7767592 CTGGGGAAGGGAGGAATGGCTGG - Intronic
969986520 4:11217313-11217335 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
971492453 4:27227406-27227428 CTGATGCAGGAAGATCTGTCTGG - Intergenic
971798544 4:31259290-31259312 CTGCTGCAGGGAGGTGTGGAGGG + Intergenic
971916669 4:32878965-32878987 CTGGTGTAGTGAGGCATGTATGG - Intergenic
978465194 4:109001278-109001300 TTGCTGCAGGGAGGCAAGTCAGG - Intronic
985716598 5:1466627-1466649 CTGGTGAATGGAGGCATGGCGGG + Intronic
987138095 5:14918398-14918420 CTGGTAAAGACAGGTATGTCTGG + Intergenic
990434942 5:55780386-55780408 CTGGTGAAAGAAGGTATGTGGGG - Intronic
998127624 5:139635180-139635202 ATGGTTCAGGGAGGTAGGCCTGG + Intergenic
999976886 5:156920974-156920996 CTGTTTCAGGGCAGTATGTCAGG - Intronic
1003076594 6:2988470-2988492 CTGGTGGAGGGATGCATGGCGGG + Intronic
1006398336 6:33801565-33801587 CTGGGGCAGGGAGGTCTCTCTGG - Intronic
1006467306 6:34203243-34203265 CTGCAGCAGGGAGGTACGGCTGG - Intergenic
1006500743 6:34457549-34457571 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1012858227 6:104528133-104528155 CTGGAGCAGGGATGGTTGTCAGG + Intergenic
1018375847 6:163211934-163211956 GTGGTCCAGGGAGGGGTGTCAGG + Intronic
1021289585 7:18826288-18826310 CTGCTGCAGGCAGGTTTGTGAGG + Intronic
1027460574 7:78447909-78447931 AGGGTGCAGAGAGGTATGTAGGG - Intronic
1028810803 7:95083428-95083450 CTGTTTCAGGGAGGAATGTGAGG + Intronic
1033431587 7:141294427-141294449 CTGGTGCAAGCAGGTCTGGCTGG + Intronic
1034541448 7:151760887-151760909 CTGGGGCAAGGAGATGTGTCAGG + Intronic
1035208362 7:157309641-157309663 CAGCTGCAGGGAGGTAGGTGAGG + Intergenic
1035293551 7:157854901-157854923 CTGTTGCAGGGATGTGTGTGGGG + Intronic
1035649285 8:1252996-1253018 CTGGTGCTGGGAGGCCTGTGGGG - Intergenic
1036635294 8:10546399-10546421 CTGTTGCAGGGAGGGATTTAGGG - Intronic
1039057577 8:33548899-33548921 CTGGAGCAGCGTGGTCTGTCTGG - Intronic
1041292210 8:56318817-56318839 CTGGGGAAGGGAGGTAACTCAGG - Intronic
1041509771 8:58643451-58643473 TGGGGGCAGGGAGGTATGACAGG - Intronic
1043804443 8:84653689-84653711 CTGTTTTATGGAGGTATGTCAGG - Intronic
1044614072 8:94121205-94121227 CTGTTTCAGGTAGGTATATCAGG - Intergenic
1046419318 8:113959174-113959196 CTGGGGAAGGGAGGTAGGGCTGG - Intergenic
1048219623 8:132529360-132529382 CTGGTGTAGGGAAGTATATCTGG + Intergenic
1048353745 8:133636620-133636642 CAGGTGCAGGGAGGTACATGAGG + Intergenic
1048354683 8:133643347-133643369 TTGGTGCAGGGATGCTTGTCAGG + Intergenic
1049199543 8:141333302-141333324 CTGGTGGAGGGAGGTGAGGCTGG + Intergenic
1049235639 8:141510906-141510928 ATGGTGGAGGAATGTATGTCAGG + Intergenic
1051756085 9:20402383-20402405 AAGTTGCAGGGAGGTATGTTTGG + Intronic
1053068886 9:35089106-35089128 CTGGTTCAGGCAGCTATTTCTGG - Exonic
1053875413 9:42540548-42540570 CTACAGCAGGGAGGTATGGCTGG + Intergenic
1054236287 9:62561176-62561198 CTACAGCAGGGAGGTATGGCTGG - Intergenic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1058539705 9:105998961-105998983 CTGCTGCAGTGTGGCATGTCAGG + Intergenic
1059708789 9:116848330-116848352 CAAGTGCAGGGAGGTATTTGGGG + Intronic
1061023919 9:128035150-128035172 CTGGTGCAGGGAGAAAGCTCAGG - Intergenic
1061550120 9:131329503-131329525 CTGGTGCAGGGAGGCTTTTGAGG - Intergenic
1062184591 9:135211274-135211296 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1203772544 EBV:56978-57000 CTGTTCCTGGTAGGTATGTCCGG + Intergenic
1203367857 Un_KI270442v1:274015-274037 CTGGTGCAGGGATGCATGGCGGG + Intergenic
1186168177 X:6849090-6849112 CTGGAGCTGGGAAGTATGTGGGG + Intergenic
1186879882 X:13854206-13854228 CTGCTGCAGGGAAGTGTGCCTGG + Intronic
1189360020 X:40343304-40343326 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1190076731 X:47322443-47322465 CAGGAGCAGGGAGGGATGCCTGG - Intergenic
1191221068 X:57989293-57989315 CTGCAGCAGGGAGGTATGTCTGG + Intergenic
1193756905 X:85419605-85419627 CTGTTGCAGGGGGGAATCTCTGG + Intergenic
1196603256 X:117625938-117625960 GTGGTTCAGTGAGGTAGGTCTGG - Intergenic
1196883850 X:120224199-120224221 CTGCAGCAGGGAGGCATGGCTGG - Intergenic
1197979229 X:132198263-132198285 CTGGGGCAGGGAGATCTGTAAGG - Intergenic
1199760064 X:150898512-150898534 CTGGTCCAGCGAGGTAAGGCGGG - Exonic
1199790629 X:151152089-151152111 CTGGTGCTAGGAGGTATCCCGGG - Intergenic
1200286865 X:154831135-154831157 CAGGTGTAGGAAGGAATGTCCGG - Intronic
1201070830 Y:10146226-10146248 CTGGTGCAGGGATGCATGGTGGG - Intergenic
1201498223 Y:14613127-14613149 GTGGTGCAGGGAGGGGTGTCTGG - Intronic