ID: 953458646

View in Genome Browser
Species Human (GRCh38)
Location 3:43063744-43063766
Sequence ACTGATAGGAAGACTTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953458643_953458646 -4 Left 953458643 3:43063725-43063747 CCAAAAGGAGTGTTTGGAGACTG No data
Right 953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG No data
953458642_953458646 -1 Left 953458642 3:43063722-43063744 CCTCCAAAAGGAGTGTTTGGAGA No data
Right 953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG No data
953458641_953458646 0 Left 953458641 3:43063721-43063743 CCCTCCAAAAGGAGTGTTTGGAG No data
Right 953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953458646 Original CRISPR ACTGATAGGAAGACTTAGGA AGG Intergenic
No off target data available for this crispr