ID: 953464384

View in Genome Browser
Species Human (GRCh38)
Location 3:43105991-43106013
Sequence GGCGGTCGCTGCGAACCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953464384_953464393 19 Left 953464384 3:43105991-43106013 CCGCCGGGTTCGCAGCGACCGCC 0: 1
1: 0
2: 1
3: 10
4: 42
Right 953464393 3:43106033-43106055 TCCGCCGTGCGCCTGCCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 80
953464384_953464392 16 Left 953464384 3:43105991-43106013 CCGCCGGGTTCGCAGCGACCGCC 0: 1
1: 0
2: 1
3: 10
4: 42
Right 953464392 3:43106030-43106052 GTGTCCGCCGTGCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 74
953464384_953464387 -6 Left 953464384 3:43105991-43106013 CCGCCGGGTTCGCAGCGACCGCC 0: 1
1: 0
2: 1
3: 10
4: 42
Right 953464387 3:43106008-43106030 ACCGCCACCTCCAGGCTCGCAGG 0: 1
1: 0
2: 2
3: 10
4: 240
953464384_953464397 29 Left 953464384 3:43105991-43106013 CCGCCGGGTTCGCAGCGACCGCC 0: 1
1: 0
2: 1
3: 10
4: 42
Right 953464397 3:43106043-43106065 GCCTGCCCGGCGGGCGAGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 166
953464384_953464395 20 Left 953464384 3:43105991-43106013 CCGCCGGGTTCGCAGCGACCGCC 0: 1
1: 0
2: 1
3: 10
4: 42
Right 953464395 3:43106034-43106056 CCGCCGTGCGCCTGCCCGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953464384 Original CRISPR GGCGGTCGCTGCGAACCCGG CGG (reversed) Exonic
900204970 1:1427791-1427813 GGCGGCCGCTGCGAAACCCCGGG + Intergenic
903077913 1:20786673-20786695 GGCGGGGGCGGAGAACCCGGGGG + Exonic
904782976 1:32964492-32964514 GGCGGCGGCTGCGCAGCCGGGGG + Exonic
905734350 1:40315618-40315640 GGCGGTCCCGGGGGACCCGGGGG + Exonic
911116080 1:94247730-94247752 GGCGGTAGCTGCAAAGGCGGCGG - Intronic
918451552 1:184664196-184664218 GGCGCTCGCTGCGGAGCTGGGGG + Intergenic
920394142 1:205631731-205631753 GGCAGCCGCTGCGACCCCCGCGG + Exonic
922782589 1:228264570-228264592 GGCTGTTCCTGCAAACCCGGAGG + Intronic
1077093569 11:790073-790095 GACGGCGGCTGCGAACGCGGAGG + Exonic
1087175234 11:95089905-95089927 GGCGGCCTCTGCGAGCGCGGCGG - Exonic
1088893436 11:114061132-114061154 GGGGGTCGCTGGGAACTGGGGGG + Intronic
1096788904 12:54033320-54033342 GGCGGTCGGGGTGAGCCCGGGGG - Exonic
1097058814 12:56267283-56267305 GGGGGTCGCTGCGAACCCCGGGG + Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117803231 14:59465351-59465373 GGCGGTCGCTGGGGACCTGGCGG + Intronic
1130115307 15:81000963-81000985 GGCGGCGGCGGCGAGCCCGGGGG + Exonic
1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG + Exonic
1134588880 16:15435539-15435561 GGAGGTCCCTGCAAACCCGGGGG + Intronic
1140927649 16:79599387-79599409 GGCGGCCGCGGCGATCACGGCGG + Exonic
1144339792 17:14301833-14301855 CGAGGGCGCTGCGAGCCCGGAGG + Exonic
1147006296 17:37406784-37406806 GGCGGGCGCTCAGCACCCGGCGG + Intronic
1148895147 17:50835258-50835280 GCCGGGCGATGCTAACCCGGTGG + Intronic
1160213805 18:76908458-76908480 GGTGGTCGCAGCGAACCCCGAGG + Exonic
1160807791 19:1000307-1000329 CGCGGTTGCTGGGAACCCGGAGG + Intergenic
1162111913 19:8404014-8404036 GGTGGGCGCTGAGAGCCCGGGGG - Exonic
1162733744 19:12734383-12734405 TCGGGTCGCTGCGGACCCGGGGG + Exonic
1166306848 19:41940234-41940256 GGCGGGCGCGGGGAGCCCGGGGG + Intergenic
1168103413 19:54153031-54153053 GGCGGTGGCGGCGAAGCCGGGGG - Intronic
926139512 2:10359899-10359921 GGCGGGCGCTGTGGACCCGGCGG - Intronic
926139518 2:10359917-10359939 GGCGGGCGCTGTGGACCCGGCGG - Intronic
926139524 2:10359935-10359957 GGTGGGCGCTGTGGACCCGGCGG - Intronic
932699963 2:73985347-73985369 GGCGGGGGCTGCGAAGCCGCCGG + Intergenic
947860522 2:233354543-233354565 GGCGGTTGCGGGGGACCCGGCGG - Exonic
1183601536 22:38843240-38843262 GGCGGTCGATGCGGTCCCGCAGG + Exonic
1183780228 22:39994823-39994845 GGAGGTCCCGGCGAGCCCGGCGG + Intergenic
953464384 3:43105991-43106013 GGCGGTCGCTGCGAACCCGGCGG - Exonic
954401343 3:50321338-50321360 GGCGGGCGGTGCAAACCTGGCGG - Exonic
972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG + Intergenic
973159118 4:46993800-46993822 GTCGGGGGCTGCGAAGCCGGAGG - Exonic
979205475 4:118033387-118033409 GGCGGCCGCCGCCAACCCGCCGG + Intergenic
991371606 5:65925681-65925703 GGCGGTTGGGGCGAAGCCGGCGG + Intergenic
998152632 5:139765815-139765837 GGCGGTGGCGGCGGACCCGGAGG - Intergenic
998286907 5:140871149-140871171 GGCGGGCGCCGCGAGCCCAGAGG + Exonic
1006090204 6:31624283-31624305 GGCAGTGGCTGCGATTCCGGCGG - Exonic
1023838699 7:44083043-44083065 GGCGGTCGCTTCAAACACGCGGG + Intergenic
1029417198 7:100450665-100450687 GGCGGCCGCGGCGAAGCTGGGGG - Intergenic
1034458927 7:151187416-151187438 GGGGGTTGCTGAGAACCAGGGGG - Intronic
1036690367 8:10941179-10941201 GGAGGAGGCTGTGAACCCGGAGG - Intronic
1046031455 8:108787593-108787615 GGCGGGCGCTGCCCACCCGGCGG - Exonic
1049759762 8:144326674-144326696 CTCGGGCGCTACGAACCCGGCGG - Exonic
1060200934 9:121651554-121651576 GGCGGGGGCTGGGGACCCGGAGG - Intronic
1061540735 9:131276915-131276937 GGCGGCCGCGGCGAAGCAGGCGG - Intergenic
1062481473 9:136754457-136754479 GGCGGGCGCTCCGAACCTTGTGG + Exonic
1190108495 X:47574696-47574718 GGGGGTCGCTGCTGAGCCGGGGG + Exonic