ID: 953465235

View in Genome Browser
Species Human (GRCh38)
Location 3:43114100-43114122
Sequence TTTGGGGGCATTGCAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953465235_953465242 8 Left 953465235 3:43114100-43114122 CCTGTAGCTGCAATGCCCCCAAA No data
Right 953465242 3:43114131-43114153 TCAACAGGAAGTCAGAGGACAGG No data
953465235_953465241 3 Left 953465235 3:43114100-43114122 CCTGTAGCTGCAATGCCCCCAAA No data
Right 953465241 3:43114126-43114148 AGCATTCAACAGGAAGTCAGAGG No data
953465235_953465238 -7 Left 953465235 3:43114100-43114122 CCTGTAGCTGCAATGCCCCCAAA No data
Right 953465238 3:43114116-43114138 CCCCAAAGTAAGCATTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953465235 Original CRISPR TTTGGGGGCATTGCAGCTAC AGG (reversed) Intergenic
No off target data available for this crispr