ID: 953468923 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:43150239-43150261 |
Sequence | GTGACCCAACAGCTGGGGTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
953468913_953468923 | 28 | Left | 953468913 | 3:43150188-43150210 | CCTTTATGATATCTGGAGTCTCA | No data | ||
Right | 953468923 | 3:43150239-43150261 | GTGACCCAACAGCTGGGGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
953468923 | Original CRISPR | GTGACCCAACAGCTGGGGTA TGG | Intergenic | ||
No off target data available for this crispr |