ID: 953468923

View in Genome Browser
Species Human (GRCh38)
Location 3:43150239-43150261
Sequence GTGACCCAACAGCTGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953468913_953468923 28 Left 953468913 3:43150188-43150210 CCTTTATGATATCTGGAGTCTCA No data
Right 953468923 3:43150239-43150261 GTGACCCAACAGCTGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953468923 Original CRISPR GTGACCCAACAGCTGGGGTA TGG Intergenic
No off target data available for this crispr