ID: 953469660

View in Genome Browser
Species Human (GRCh38)
Location 3:43155867-43155889
Sequence CAGTAAACGGACGCTGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953469660_953469669 29 Left 953469660 3:43155867-43155889 CCCGCAGCAGCGTCCGTTTACTG No data
Right 953469669 3:43155919-43155941 ACTACCACCACTGCAACCACAGG No data
953469660_953469665 4 Left 953469660 3:43155867-43155889 CCCGCAGCAGCGTCCGTTTACTG No data
Right 953469665 3:43155894-43155916 CTGCCCTCGCCTGGAATCTTAGG No data
953469660_953469663 -5 Left 953469660 3:43155867-43155889 CCCGCAGCAGCGTCCGTTTACTG No data
Right 953469663 3:43155885-43155907 TACTGCCTGCTGCCCTCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953469660 Original CRISPR CAGTAAACGGACGCTGCTGC GGG (reversed) Intergenic
No off target data available for this crispr