ID: 953470798

View in Genome Browser
Species Human (GRCh38)
Location 3:43164217-43164239
Sequence CACAAGATCGTGTCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953470798_953470801 -1 Left 953470798 3:43164217-43164239 CCTGCAGGAGACACGATCTTGTG No data
Right 953470801 3:43164239-43164261 GATGGAGTCTCCCATGAGCAGGG No data
953470798_953470800 -2 Left 953470798 3:43164217-43164239 CCTGCAGGAGACACGATCTTGTG No data
Right 953470800 3:43164238-43164260 TGATGGAGTCTCCCATGAGCAGG No data
953470798_953470802 4 Left 953470798 3:43164217-43164239 CCTGCAGGAGACACGATCTTGTG No data
Right 953470802 3:43164244-43164266 AGTCTCCCATGAGCAGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953470798 Original CRISPR CACAAGATCGTGTCTCCTGC AGG (reversed) Intergenic
No off target data available for this crispr