ID: 953470965

View in Genome Browser
Species Human (GRCh38)
Location 3:43165719-43165741
Sequence TTTTGGCCTGCTCTTTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953470965_953470967 -3 Left 953470965 3:43165719-43165741 CCACACTAAAGAGCAGGCCAAAA No data
Right 953470967 3:43165739-43165761 AAAATTTAAAAGAAAGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953470965 Original CRISPR TTTTGGCCTGCTCTTTAGTG TGG (reversed) Intergenic
No off target data available for this crispr