ID: 953471556

View in Genome Browser
Species Human (GRCh38)
Location 3:43170997-43171019
Sequence GACTGAAGAGTGTTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953471556_953471560 9 Left 953471556 3:43170997-43171019 CCAGCCACCAACACTCTTCAGTC No data
Right 953471560 3:43171029-43171051 ATCTACAAACATCAACAGACAGG No data
953471556_953471561 13 Left 953471556 3:43170997-43171019 CCAGCCACCAACACTCTTCAGTC No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953471556 Original CRISPR GACTGAAGAGTGTTGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr