ID: 953471561

View in Genome Browser
Species Human (GRCh38)
Location 3:43171033-43171055
Sequence ACAAACATCAACAGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953471556_953471561 13 Left 953471556 3:43170997-43171019 CCAGCCACCAACACTCTTCAGTC No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data
953471558_953471561 6 Left 953471558 3:43171004-43171026 CCAACACTCTTCAGTCCATATGT No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data
953471555_953471561 16 Left 953471555 3:43170994-43171016 CCTCCAGCCACCAACACTCTTCA No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data
953471557_953471561 9 Left 953471557 3:43171001-43171023 CCACCAACACTCTTCAGTCCATA No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data
953471559_953471561 -9 Left 953471559 3:43171019-43171041 CCATATGTTCATCTACAAACATC No data
Right 953471561 3:43171033-43171055 ACAAACATCAACAGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953471561 Original CRISPR ACAAACATCAACAGACAGGC AGG Intergenic
No off target data available for this crispr