ID: 953473246

View in Genome Browser
Species Human (GRCh38)
Location 3:43184474-43184496
Sequence CTCCCTAGAAGGAGCTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953473246_953473252 -10 Left 953473246 3:43184474-43184496 CCCGAAGAGCTCCTTCTAGGGAG No data
Right 953473252 3:43184487-43184509 TTCTAGGGAGGGCCAGGCACTGG No data
953473246_953473253 -6 Left 953473246 3:43184474-43184496 CCCGAAGAGCTCCTTCTAGGGAG No data
Right 953473253 3:43184491-43184513 AGGGAGGGCCAGGCACTGGCAGG No data
953473246_953473257 24 Left 953473246 3:43184474-43184496 CCCGAAGAGCTCCTTCTAGGGAG No data
Right 953473257 3:43184521-43184543 CACCACCACTTAGACCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953473246 Original CRISPR CTCCCTAGAAGGAGCTCTTC GGG (reversed) Intergenic
No off target data available for this crispr