ID: 953473500

View in Genome Browser
Species Human (GRCh38)
Location 3:43186118-43186140
Sequence TGAACTCAATTTAGTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953473500_953473505 11 Left 953473500 3:43186118-43186140 CCTTCAGCACTAAATTGAGTTCA No data
Right 953473505 3:43186152-43186174 CATTGTCACTTTAACCAAGCGGG No data
953473500_953473507 17 Left 953473500 3:43186118-43186140 CCTTCAGCACTAAATTGAGTTCA No data
Right 953473507 3:43186158-43186180 CACTTTAACCAAGCGGGAGGAGG No data
953473500_953473504 10 Left 953473500 3:43186118-43186140 CCTTCAGCACTAAATTGAGTTCA No data
Right 953473504 3:43186151-43186173 CCATTGTCACTTTAACCAAGCGG No data
953473500_953473506 14 Left 953473500 3:43186118-43186140 CCTTCAGCACTAAATTGAGTTCA No data
Right 953473506 3:43186155-43186177 TGTCACTTTAACCAAGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953473500 Original CRISPR TGAACTCAATTTAGTGCTGA AGG (reversed) Intergenic